Choline increases acetylcholine release and protects against the stimulation-induced decrease in phosphatide levels within membranes of rat corpus striatum

This study examined the possibility that membrane phospholipids might be a source of choline used for acetylcholine (ACh) synthesis. Slices of rat striatum or cerebellum were superfused with a choline-free or choline-containing (10, 20 or 40 microM) physiological solution with eserine, for alternating 20 min periods of rest or electrical stimulation. Superfusion media were assayed for choline and ACh, and slice samples taken before and after stimulation were assayed for choline, ACh, various phospholipids, protein and DNA. The striatal slices were able to sustain the stimulation-induced release of ACh, releasing a total of about 3 times their initial ACh contents during the 8 periods of stimulation and rest. During these 8 cycles, 885 pmol/micrograms DNA free choline was released from the slices into the medium, an amount about 45-fold higher than the initial or final free choline levels in the slices. Although repeated stimulation of the striatal slices failed to affect tissue levels of free choline or of ACh, this treatment did cause significant, dose-related (i.e., number of stimulation periods) stoichiometric decreases in tissue levels of phosphatidylcholine (PC) and of the other major phospholipids; tissue protein levels also declined significantly. Addition of exogenous choline to the superfusion medium produced dose-related increases in resting and evoked ACh release. The choline also fully protected the striatal slices from phospholipid depletion for as many as 6 stimulation periods. Cerebellar slices liberated large amounts of free choline into the medium but did not release measurable quantities of ACh; their phospholipid and protein levels did not decline with electrical stimulation. These data show that membrane phospholipids constitute a reservoir of free choline that can be used for ACh synthesis. When free choline is in short supply, ACh synthesis and release are sustained at the expense of this reservoir. The consequent reduction in membrane PC apparently is associated with a depletion of cellular membrane. The use of free choline by cholinergic neurons for two purposes, the syntheses of both ACh and membrane phospholipids, may thus impart vulnerability to them in situations where the supply of free choline is less than that needed for acetylation.

Acetylcholine Neurotransmission (Section 1, Chapter 11) Neuroscience Online: An Electronic Textbook for the Neurosciences | Department of Neurobiology and Anatomy

11.1 Introduction

Acetylcholine, the first neurotransmitter discovered, was originally described as “vagus stuff” by Otto Loewi because of its ability to mimic the electrical stimulation of the vagus nerve. It is now known to be a neurotransmitter at all autonomic ganglia, at many autonomically innervated organs, at the neuromuscular junction, and at many synapses in the CNS.

In this chapter we will discuss the acetylcholine’s anatomy, cell biology, physiological effects, role in behavior, and clinical applications.

11.2 Acetylcholine in the Autonomic Nervous System

In the autonomic nervous system, acetylcholine (ACh) is the neurotransmitter in the preganglionic sympathetic and parasympathetic neurons. These are shown in Figure 11.2 as the red ACh in the ganglion. ACh is also the neurotransmitter at the adrenal medulla and serves as the neurotransmitter at all the parasympathetic innervated organs. ACh is also the neurotransmitter at the sweat glands, and at the piloerector muscle of the sympathetic ANS (Labeled in blue in Figure 11.2).

11.3 ACh in the Peripheral Nervous System

In the peripheral nervous system, ACh is the neurotransmitter at the neuromuscular junction between the motor nerve and skeletal muscle.

11.4 ACh in the Central Nervous System

In the central nervous system, ACh is found primarily in interneurons, shown in Figure 11.3 as orange and green cell clusters. A few important long-axon cholinergic pathways have also been identified. Noteworthy is the cholinergic projection from the nucleus basalis of Meynert (in the basal forebrain) to the forebrain neocortex and associated limbic structures, represented by the black pathway in Figure 11.3. Degeneration of this pathway is one of the pathologies associated with Alzheimer’s disease. There is also a projection from the medial septal and diagonal band region to limbic structures (blue). Most subcortical areas are innervated by neurons from the ponto-mesencephalic region (purple in Figure 11.3).

11.5 Introduction to the Cell Biology of the Cholinergic Synapse

Figure 11.4 is a summary of the biological mechanisms involved in the synthesis, storage secretion, receptor interaction and termination of acetylcholine. Click on the region of the cell describing these processes to learn more about each one.

Click on the blocks marked (above) to see details,
or choose from the list below.

1. Synthesis of Acetylcholine
2. Storage of Acetylcholine
3. Release of Acetylcholine
4. Acetylcholine Receptors
   1. Nicotinic
   2. Muscarinic
5. Termination of Acetylcholine Action

11.6 Synthesis of ACh

Choline acetyltransferase (CAT): As shown in Figure 11.5, ACh is synthesized by a single step reaction catalyzed by the biosynthetic enzyme choline acetyltransferase. As is the case for all nerve terminal proteins, CAT is produced in the cholinergic cell body and transported down the axon to the nerve endings. Both CAT and ACh may be found throughout the neuron, but their highest concentration is in axon terminals. The presence of CAT is the “marker” that a neuron is cholinergic, only cholinergic neurons contain CAT.

The rate-limiting steps in ACh synthesis are the availability of choline and acetyl-CoA. During increased neuronal activity the availability of acetyl-CoA from the mitochondria is upregulated as is the uptake of choline into the nerve ending from the synaptic cleft. Ca²⁺ appears to be involved in both of these regulatory mechanisms. As will be described later, the inactivation of ACh is converted by metabolism to choline and acetic acid. Consequently much of the choline used for ACh synthesis comes from the recycling of choline from metabolized ACh. Another source is the breakdown of the phospholipid, phosphatidylcholine. One of the strategies to increase ACh neurotransmission is the administration of choline in the diet. However, this has not been effective, probably because the administration of choline does not increase the availability of choline in the CNS.

11.7 Storage of ACh

The majority of the ACh in nerve endings is contained in clear (as viewed in the electron microscope) 100 um vesicles. A small amount is also free in the cytosol. Vesicle-bound ACh is not accessible to degradation by acetylcholinesterase (see below).

The uptake of ACh into storage vesicle occurs through an energy-dependent pump that acidifies the vesicle. The acidified vesicle then uses a vesicular ACh transporter (VAChT) to exchange protons for ACh molecules. No useful pharmacological agents are available to modify cholinergic function through interaction with the storage of ACh.

Interestingly, the gene for VAChT is contained on the first intron of the choline acetyltransferase gene. This proximity implies the two important cholinergic proteins are probably regulated coordinately.

11.8 Release of ACh

The release of ACh occurs through Ca²⁺ stimulated docking, fusion, and fission of the vesicle with the nerve terminal membrane, as discussed previously.

You will recall that the miniature endplate potentials and the quantal release in response to action potentials at the neuromuscular junction are due to the release of packets of ACh from individual storage vesicles (Chapter 5). Many toxins are known that interfere with these processes and are effective in preventing ACh secretion. The examples in Figure 11.6 shows botulinum toxin inhibition and black widow spider venom (BWSV) stimulation of ACh release.

11.9 ACh Receptors

There are two broad classes of cholinergic receptors: nicotinic and muscarinic. This classification is based on two chemical agents that mimic the effects of ACh at the receptor site nicotine and muscarine.

Table I summarizes some of the properties of nicotinic and muscarinic receptors.

11.10 The Nicotinic Receptor is an Ion Channel

As indicated in Table I, nicotinic receptors are located at the NMJ, autonomic ganglia and sparsely in the CNS.

The NMJ nicotinic ACh receptor consists of five polypeptide subunits: two α subunits and one each of β, δ, and γ (see Figure 11.8). A funnel-shaped internal ion channel is surrounded by the five subunits. The binding surface of the receptor appears to be primarily on the α subunits, near the outer surface of the molecule. The subunits contain recognition sites for agonists, reversible antagonists, and α-toxins (cobra α-toxin and α-bungarotoxin).

Whereas the NMJ nicotinic receptor is composed of four different species of subunit (2 α, β, γ, δ), the neuronal nicotinic receptor also is composed of only two subunit types (2 α and 3 β).

11.11 The Muscarinic Receptor is Coupled to G-Proteins

Muscarinic receptors, classified as G protein coupled receptors (GPCR), are located at parasympathetic autonomically innervated visceral organs, on the sweat glands and piloerector muscles and both post-synaptically and pre-synaptically in the CNS (see Table I). The muscarinic receptor is composed of a single polypeptide. Seven regions of the polypeptide are made up of 20-25 amino acids arranged in an α helix. Because each of these regions of the protein is markedly hydrophobic, they span the cell membrane seven times as depicted in Figure 11.9. The fifth internal loop and the carboxyl-terminal tail of the polypeptide receptor are believed to be the site of the interaction of the muscarinic receptor with G proteins (see right). The site of agonist binding is a circular pocket formed by the upper portions of the seven membrane-spanning regions.

ACh has excitatory actions at the neuromuscular junction, at autonomic ganglion, at certain glandular tissues and in the CNS. It has inhibitory actions at certain smooth muscles and at cardiac muscle.

The biochemical responses to stimulation of muscarinic receptor involve the receptor occupancy causing an altered conformation of an associated GTP-binding protein (G protein). G protein is made up of the three subunits α, β and γ. In response to the altered conformation of the muscarinic receptor, the a subunit of the G protein releases bound guanosine diphosphate (GDP) and simultaneously binds guanosine triphosphate (GTP). The binding of GTP “activates” the G protein, allowing dissociation of the α subunit from the trimeric complex and for it to interact with effector systems to mediate specific responses. An inherent GTPase catalytic activity of the G protein hydrolyzes the GTP back to GDP. This hydrolysis terminates the action of the G protein. The rate of hydrolysis of the GTP thus dictates the length of time the G protein remains activated.

The responses mediated by muscarinic receptors through G proteins include:

Inhibition of Adenylate Cyclase: The muscarinic receptor, through interaction with an inhibitory GTP-binding protein, acts to inhibit adenylyl cyclase. Reduced cAMP production leads to reduced activation of cAMP-dependent protein kinase, reduced heart rate, and contraction strength.

Stimulation of Phospholipase C: The muscarinic receptor activates phosphoinositide-specific phospholipase C (PLC_β) through interaction with a GTP-binding protein. As shown in Figure 11.12a, the hydrolysis of phosphatidylinositol bisphosphate yields two second messengers; inositol trisphosphate (IP₃) and diacylglycerol (DAG). The DAG activates protein kinase C (not shown). Cellular responses are influenced by PKC’s phosphorylation of target proteins. As shown in Figure 11.12b, the IP₃ diffuses to the smooth endoplasmic reticulum (ER) where it interacts with IP₃ receptors to increase Ca²⁺ release from the intracellular storage site.

Activation of K⁺ Channels: In response to muscarinic cholinergic receptor stimulation, a GTP binding protein also can interact directly with K⁺ channels to increase K⁺ conductance, (Figure 11.13). This conductance increase increases the resting membrane potential in myocardial and other cell membranes leading to inhibition.

11.12 Termination of ACh Action

ACh binds only briefly to the pre- or postsynaptic receptors. Following dissociation from the receptor, the ACh is rapidly hydrolyzed by the enzyme acetylcholinesterase (AChE) as shown in Figure 11.14. This enzyme has a very high catalysis rate, one of the highest known in biology. AChE is synthesized in the neuronal cell body and distributed throughout the neuron by axoplasmic transport. AChE exists as alternatively spliced isoforms that vary in their subunit composition. The variation at the NMJ is a heteromeric protein composed of four subunits coupled to a collagen tail that anchors the multi-subunit enzyme to the cell membrane of the postsynaptic cell (Figure 11.14). This four-subunit form is held together by sulfhydryl bonds and the tail anchors the enzyme in the extracellular matrix at the NMJ. Other isoforms are homomeric and freely soluble in the cytoplasm of the presynaptic cell. AChE, unlike ChAT, is found in non-cholinergic neurons as well. In addition, other cholinesterases exist throughout the body, which are also able to metabolize acetylcholine. These are termed pseudocholinesterases.

Drugs that inhibit ACh breakdown are effective in altering cholinergic neurotransmission. In fact, the irreversible inhibition of AChE by isopropylfluoroesters are so toxic that they can be incompatible with life—inhibiting the muscles for respiration. This inhibition is produced because ACh molecules accumulate in the synaptic space, keep the receptors occupied, and cause paralysis. Two notable examples are insecticides and the gases used in biological warfare. The mechanism of action of these irreversible inhibitors of AChE is that they carbamylate the AChE, rendering it inactive. The carbamylation inactivates both the acetyl and choline binding domains. A recently developed antidote to these inhibitors cleaves the nerve gas so that it will dissociate from the AChE.

In contrast to the irreversible inhibitors, the reversible AChE inhibitors are effective in transiently increasing the ACh level and are effective in diseases and conditions where an increased ACh level is desired. The clinically important compound, eserine (physostigmine), reversibly inhibits AChE.

11.13 Physiology

Nicotinic receptor activation causes the opening of the channel formed by the receptor. This increases the Na+ movement into the target cell, leading to depolarization and generation of the action potential. This rapidly developing change, termed a fast EPSP, is illustrated in Figures 4.3, and 6.2.

Muscarinic receptor activation of postsynaptic cells can be either excitatory or inhibitory and is always slow in onset and long in duration (Table I). Figure 11.16 and Figure 11.17 illustrate an excitatory and an inhibitory postsynaptic potential in the sympathetic ganglion. As described earlier, G protein activation underlies all actions of the muscarinic receptors, thus accounting for their slow onset.

11.14 Behavior

The rapid nature of the synaptic transmission mediated by the nicotinic receptor is consistent with its role at the NMJ and in the ganglion of the ANS. Little is known about the role of the nicotinic receptor role in CNS behavior. Clearly, nicotine stimulation is related in some manner to reinforcement, as indicated by the prevalence of nicotine addiction among humans.

Muscarinic receptors, in contrast, are important mediators of behavior in the CNS. One example is their role in modulating motor control circuits in the basal ganglia. A second example is their participation in learning and memory. The latter is inferred from two types of observations: 1) muscarinic antagonists are amnesic agents, and 2) deterioration of the cholinergic innervation of the neocortex is associated with memory loss in Alzheimer’s disease.

11.15 Clinical

Alzheimer’s disease: A disease in which a marked deterioration occurs in the CNS, the hallmark of which is a progressive dementia. One of the characteristics of this disease is a marked decrease in ACh concentrations in the cerebral cortex and caudate nucleus.

Myasthenia gravis: A disease of the neuromuscular junction in which the receptors for ACh are destroyed through the actions of the patient’s own antibodies.

Cholinergic Pharmacology: Numerous drugs are used clinically to interact with the cholinergic systems. Table II summarizes the major uses for cholinergic drugs.

11.16 Cholinergic Pharmacological Agents

Test Your Knowledge

In vivo blockade of acetylcholinesterase increases intraovarian acetylcholine and enhances follicular development and fertility in the rat

Animals

Adult female Sprague Dawley rats between 250–300 g from our facilities were used. Rats were maintained with food and water ad libitum and a 12:12 hours day:night cycle. The experiments with HupA were designed to achieve an effective local intraovarian concentration of HupA, a specific pharmacological blocker of AChE¹². The constant delivery of the drug was achieved by means of an Alzet osmotic minipump (model 2004, Alza Corp., Palo Alto, CA, USA) filled with a 10 μM HupA solution or with saline, in the case of sham operated control. The implantation method has been used previously in our laboratory^15,23. In order to eliminate the contribution of the contralateral ovary to the changes in reproductive function produced by HupA, we used hemiovariectomized rats (removal of the right ovary), which were divided into two main groups: sham control rats (n = 25) implanted with the minipump filled with saline. In the second group (n = 25) the minipump was filled with 10 μM HupA solution. Both control and HupA-treated rats were examined by daily vaginal smears to verify estrous cycle regularity. Results are presented as the percentage of regular cycling activity considering the following stage of the estrous cycle: proestrus (P), estrus (E), diestrus (D). Control rats presented a regular 4-days estrual activity. Rats were euthanized by decapitation at 11:00 h of the diestrus phase of the estrous cycle. To study fertility, 5 of the HupA-treated rats and 5 control rats were mated with fertile male the night of proestrus. Either control or HupA treated rats were checked for the presence of sperm forming the vaginal plug the other day. Rats with Sperm positive rats were assigned with pregnancy day-1. During delivery, born pups were counted and maintained with the mother during 3 days. At day 3 mothers were euthanized to verify the implantation sites in the uterus and pups were derived to other lactating mother. Ovaries were used for histology, biochemical measurements, morphometry and ACh determination and each experimental group contained five replicates. All experimental procedures were approved by the Bioethics Committee of the Faculty of Chemistry and Pharmaceutical Sciences at the Universidad de Chile and complied with national guidelines (CONICYT Guide for the Care and Use of Laboratory Animals). All efforts were made to minimize the number of animals used and their suffering.

Isolation of granulosa and residual ovary cells fraction

Granulosa cells were collected as described previously^24,25. Briefly, ovaries were punctured with a needle, and the cell suspension was carefully expressed into Krebs bicarbonate buffer. The cells were transferred to a 1.5 ml plastic tube, pelleted by centrifugation at 3000 × g, and washed three times with Krebs bicarbonate buffer. With this method we have previously found that more than 90% of the mRNA for FSH receptor is located in the granulosa cell fraction²⁴. Both the suspension of granulosa cells and the rest of the ovary (residual ovary containing theca-interstitial cells, blood vessels, nerve terminals, etc.) were used for extraction of total RNA to do the RT-PCR or qPCR.

AChE expression in the rat ovary

To examine BuChE, AChE and isoforms, we used RT-PCR and qPCR with mRNA obtained from the complete rat ovary or the granulosa theca-interstitial cell fractions. RNA extraction from 10 mg of tissue or the isolated fractions of cells was done using the Total RNA E.Z.N.A Kit I (Omega Bio-Tek, Norcross, GA, USA) according to the supplier’s instructions. We verified the integrity of the RNA with an agarose gel electrophoresis and the total amount of RNA was quantified with the Kit Quant-IT RNA Br (Molecular Probes, Carlsbad, CA, USA). A total of 5 μg of total RNA was incubated with reverse transcriptase SuperScripT II, Invitrogen, Carlsbad, CA, USA) in a final volume of 20 μl according to Dorfman et al.⁵. For qPCR analysis we used IQ5 thermocycler (Bio-Rad, Hercules, CA, USA) with Brilliant II SYBR^®Green QPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA) using 2 μl of a 1/10 dilution of the cDNA previously obtained. The primers used to detect BuChE, were obtained from Mis et al.²⁶. The sense primer was 5′AGAATGGATGGGAGTAATGCATGG3′, the antisense primer was 5′GATGGAATCCTGCCTTCCACTCTTGC3′. To detect AChE the sense primer 5′CCCATGGCTATGAAATCGAG3′ and the antisense primer 5′TTCAGGCTCACG TATTGCTC3′ were chosen based in the sequence information given NM_172009.1. In this case we sequenced to verify authenticity. To detect the AChE isoforms we used the common sense primer described by Sifringer et al.²⁷ 5′CAGCAATACGTGAGCCTG3′. To detect the S isoform we chose the antisense primer 5′GGTCGAACTGGTTCTTCCA 3′²⁷. For the H isoform we used the antisense primer 5′TTAGAGCCACCGAAGCCCGG3′ and for the R isoform we used the antisense primer 5′CTTCCAACCCTTGCCGCC3′, both obtained from Legay et al.²⁸. For qPCR determination of each transcript we used a 0.16 μM solution of each primer and the standard protocol of the supplier. Polymerase was activated at 95 °C for 10 minutes, followed by 40 cycles of alignment at 58 °C elongation at 72 °C. To quantitate we used 18S transcript as a constitutive gene.

Western blot analysis

For western blot the ovary was homogenized in 10 volumes of RIPA buffer (1% NP40, 0.5% sodium deoxycholate, 0.1% SDS in PBS; just before use add 10 μl of the following mixture (10 mg/ml stock solution of PMSF; Aprotinin and sodium ortovanadate ) in the presence of Complete Mini EDTA-Free Protease Inhibitor Cocktail (Roche, Basel, Switzerland). Proteins extracted were quantified with Lowry method²⁹ and 30 μg were run on 10% polyacrylamide gel. Proteins were transferred to nitrocellulose and incubated with an antibody that recognizes all the isoforms of AChE (E-19, Santa Cruz Biotechnology, Dallas, TX, USA). As a positive control we used a total extract from rat brain and the negative control was done with the preadsorbed antibody with the immunogenic peptide (E-19p, Santa Cruz Biotechnology).

Immunohistochemistry

The method was described previously⁹. In brief, ovaries were fixed in Bouin’s fluid, embedded in paraffin and cut at 6 μm each. Antigen recovery was done by microwave heating at 800 W for 10 minutes in buffer 10 mM citrate pH 6.0, washed 3 times with PBS. Samples were incubated for 30 minutes in 3% hydrogen peroxide with 10% methanol to block endogenous peroxidases. The AChE the polyclonal antibody E-19 from Santa Cruz Biotechnology recognizes all AChE isoforms and was used. Incubation was done overnight with 1:50 antibody solution in PBS in the presence of 5% normal donkey serum. On the second day the tissue was washed in PBS and incubated with the secondary biotinylated antibody (1:500) for 2 h. To detect the signal we used Vectastain ABC kit (VectorLabs, Burlingame, CA, USA) according to manufacturer instructions. Preadsorption was done as described for Western blotting.

Determination of ovarian endogenous ACh levels

To quantify the ACh concentration in the ovary, a complete ovary was homogenized in 10 volumes of PBS in ice and the neurotransmitter determination was done using the Amplex Red Acetylcholine Assay (Invitrogen) as described previously³⁰.

Acetylcholinesterase activity in the rat ovary.

The ovaries of 5 rats were obtained, weighted and suspended in 10 volumes of ice-cold phosphate-buffered solution (pH 7.0). The ovaries were homogenized in a glass-glass homogenizer and centrifuged at 10000 × g for 10 minutes. 15 μl of the supernatant was used to determine AChE by the method of Ellman, as described by Blohberger et al.⁹.

Morphometric analysis

Ovaries previously fixed were embedded in paraffin, cut into 6 μm sections, and stained with hematoxylin and eosin. Morphometric analyses of whole ovaries were done as previously described^15,31 using n = 4 ovaries of HupA and 5 saline controls. All follicular structures were followed through all slices and were counted when they reached the largest diameter. Primordial follicles were those with one oocyte surrounded by flattened granulosa cells; primary follicles were counted as follicles exhibiting one layer of cubical granulosa cells; secondary follicles had no antral cavity but two or more layers of granulosa cells; atretic follicles had more than 5% of cells with pyknotic nuclei in the largest cross-section and exhibited shrinkage and an occasional breakdown of the germinal vesicle; antral follicles were those with more than 3 healthy granulosa cell layers, the antrum and with a clearly visible nucleus of the oocyte; type III follicles were large follicles containing four or five plicated layers of small, densely packed granulosa cells surrounding a very large antrum with an apparently normal thecal compartment; precystic follicles do not present the oocyte but they still have many layers of granulosa cells; finally, cystic follicles were devoid of oocytes and displayed a large antral cavity, a well-defined thecal cell layer, and a thin (mostly monolayer) granulosa cell compartment containing apparently healthy cells¹⁵. All abnormal follicular structures were grouped as cystic structures.

Statistical analysis

The data are expressed as the mean + S.E.M. To determine statistical differences between 2 groups, we used two-tailed Student’s t-test. To analyze differences between several groups we used one-way analysis of variance (ANOVA) followed by a Newman-Keuls post-test (see results shown in Fig. 1B). The results shown in Fig. 1D were analyzed using column statistics (Prism GraphPad, La Jolla, Ca, USA).

An Error Occurred Setting Your User Cookie

This site uses cookies to improve performance. If your browser does not accept cookies, you cannot view this site.

Setting Your Browser to Accept Cookies

There are many reasons why a cookie could not be set correctly. Below are the most common reasons:

• You have cookies disabled in your browser. You need to reset your browser to accept cookies or to ask you if you want to accept cookies.
• Your browser asks you whether you want to accept cookies and you declined.
  To accept cookies from this site, use the Back button and accept the cookie.
• Your browser does not support cookies. Try a different browser if you suspect this.
• The date on your computer is in the past. If your computer’s clock shows a date before 1 Jan 1970,
  the browser will automatically forget the cookie. To fix this, set the correct time and date on your computer.
• You have installed an application that monitors or blocks cookies from being set.
  You must disable the application while logging in or check with your system administrator.

Why Does this Site Require Cookies?

This site uses cookies to improve performance by remembering that you are logged in when you go from page to page. To provide access without cookies
would require the site to create a new session for every page you visit, which slows the system down to an unacceptable level.

What Gets Stored in a Cookie?

This site stores nothing other than an automatically generated session ID in the cookie; no other information is captured.

In general, only the information that you provide, or the choices you make while visiting a web site, can be stored in a cookie. For example, the site
cannot determine your email name unless you choose to type it. Allowing a website to create a cookie does not give that or any other site access to the
rest of your computer, and only the site that created the cookie can read it.

Acetylcholine: Working on Working Memory

Alzheimer’s dementia is associated with the loss of cholinergic neurons that produce acetylcholine, but drugs that increase acetylcholine levels at the synapse don’t always result in significantly improved cognition. Are the drugs not good enough, or do we need to shift our focus to other neurotransmitters? Croxson and colleagues have now identified more precisely the cognitive dysfunction resulting from loss of cholinergic neurons.

The investigators studied the effects of specifically killing cholinergic neurons in the well-differentiated prefrontal cortex of rhesus monkeys, providing an approximation of the effects of reduced acetylcholine in human Alzheimer’s disease and other forms of dementia. Croxson et al. used a targeted immunotoxin to deplete such neurons in the lateral and orbital prefrontal cortex. Of note, the monkeys with prefrontal cholinergic lesions showed no deficit in a model of human episodic memory. Similarly, these lesions did not impair strategy implementation, which is a task of executive function. However, cholinergic lesions in the prefrontal cortex resulted in impaired learning in a delayed response task, which models working memory (a system that is theorized to hold and manipulate information in the short term).

The study by Croxson and colleagues clarifies the role of prefrontal acetylcholine in cognitive function by pinpointing working memory—as opposed to episodic memory and executive function—as the most susceptible to reduced acetylcholine transmission. These findings have implications for the pharmacologic treatment of Alzheimer’s disease by suggesting that the increase of acetylcholine in the prefrontal cortex can only be expected to improve working memory rather than all of the diverse cognitive functions of that brain region. This finding highlights the need to identify other neurotransmitter systems that mediate cognitive dysfunction in Alzheimer’s disease so that a multimodal pharmacologic approach can be developed. Finally, the work of Croxson et al. explains why other forms of dementia with greater cholinergic neuron loss, such as Lewy body disease, are associated with working memory dysfunction.

P. L. Croxson et al., Cholinergic modulation of a specific memory function of prefrontal cortex. Nat. Neurosci. 14, 1510–1512 (2011). [Abstract]

• Copyright © 2011, American Association for the Advancement of Science

Parkinson’s Progression May Be Tied to Imbalance in Dopamine and Acetylcholine Levels, Study Says

Therapies against motor loss and progression in Parkinson’s’ disease (PD) may need to tackle the imbalance between two neurotransmitters, dopamine and acetylcholine, instead of focusing on dopamine alone, an early study suggests.

The study, “Dopamine Deficiency Reduces Striatal Cholinergic Interneuron Function in Models of Parkinson’s Disease,” was published in the journal Neuron.

Motor and cognitive functions depends on the coordinated interaction in the brain of two neurotransmitters — substances produced in response to nerve signals that act as chemical messengers — called dopamine and acetylcholine.

In Parkinson’s, the degeneration of motor neurons that produce dopamine in a brain region called the striatum results in difficulties with voluntary movement control.

Therapies that increase dopamine or activate dopamine receptors, such as levodopa, are currently used to restore motor skills. However, these treatments are not fully effective and their benefits wear off over time.

Researchers have thought that a decline in dopamine levels would increase acetylcholine production. Higher levels of acetylcholine are suggested to cause the dyskinesia — uncontrolled, involuntary movements — observed in Parkinson’s patients under long-term dopamine therapy.

Researchers at Yale University questioned points in these assumptions. They investigated how dopamine affects acetylcholine by looking at a specific type of nerve cell, called striatal interneurons, that is the main source of acetylcholine in the striatum.

To test the effects of dopamine loss, the team used a mouse model genetically modified to mimic Parkinson’s that has a progressive decline in dopamine levels. When motor symptoms appear in these mice, it is estimated that about 30% of dopamine is already lost, increasing to 60–80% at their death.

This progressive dopamine loss, the researchers saw, was matched in the animals by an initial and smaller decrease in the production of acetylcholine by striatal interneurons, creating an imbalance.

“While the concentrations of both dopamine and acetylcholine decline, the balance between these two neurotransmitters shifts to favor acetylcholine,” the researchers wrote.

Subsequent release of dopamine from remaining axon terminals push an increase of acetylcholine, worsening the imbalance between both neurotransmitters.

Under dopamine depleted conditions, proper motor function is dependent on adequate levels of both acetylcholine and dopamine, the study concluded.

Its findings suggest that progressive dopamine deficiency reduces the activity of striatal cholinergic interneurons, resulting in progressive motor difficulties.

Future treatments aiming to slow Parkinson’s progression should include those targeting the balance between acetylcholine and dopamine.

“Our findings suggest that targeted cholinergic therapy [those that mimic the action of acetylcholine] has a place in the management PD and highlight the need for additional experiments that will offer therapeutic options distinct from disease prevention,” the researchers wrote.

Neurotransmitters and Receptors | Boundless Anatomy and Physiology

Cholinergic Neurons and Receptors

Acetylcholine is a neurotransmitter in the central and peripheral nervous systems that affects plasticity, arousal, and reward.

Learning Objectives

Identify the cholinergic neurons and receptors in the autonomic system

Key Takeaways

Key Points

• The neurotransmitter acetylcholine (ACh) is the only neurotransmitter used in the motor division of the somatic nervous system and the principal neurotransmitter at autonomic ganglia.
• In the CNS, the neurons that release and respond to ACh comprise the cholinergic system, which causes anti-excitatory effects.
• ACh plays a role in synaptic plasticity, including learning and short-term memory.
• ACh may bind either muscarinic or nicotinic receptors.
• ACh is synthesized in cholinergic neurons (such as those in the nucleus basalis of Meynert) from choline and acetyl-CoA using an enzyme called choline acetyltransferase.

Key Terms

• choline acetyltransferase: Abbreviated as ChAT, this is an enzyme that is synthesized within the body of a neuron. It is then transferred to the nerve terminal via axoplasmic flow. The role of choline acetyltransferase is to join Acetyl-CoA to choline, resulting in the formation of the neurotransmitter acetylcholine.
• autonomic ganglia: Clusters of neuronal cell bodies and their dendrites that are a junction between the autonomic nerves originating from the central nervous system and the autonomic nerves innervating their target organs in the periphery.
• nicotinic receptors: Also called nAChRs, these are cholinergic receptors that form ligand-gated ion channels in the plasma membranes of certain neurons and on the postsynaptic side of the neuromuscular junction.

Acetylcholine

Acetylcholine (ACh) is an organic, polyatomic ion that acts as a neurotransmitter in both the peripheral nervous system (PNS) and central nervous system (CNS) in many organisms, including humans. Acetylcholine is one of many neurotransmitters in the autonomic nervous system (ANS) and the only neurotransmitter used in the motor division of the somatic nervous system (sensory neurons use glutamate and various peptides at their synapses ).

Acetylcholine is also the principal neurotransmitter in all autonomic ganglia. In cardiac tissue, acetylcholine neurotransmission has an inhibitory effect, which lowers heart rate. However, acetylcholine also behaves as an excitatory neurotransmitter at neuromuscular junctions in skeletal muscle.

Acetylcholine: The chemical structure of acetylcholine is depicted.

Acetylcholine was first identified in 1914 by Henry Hallett Dale for its actions on heart tissue. It was confirmed as a neurotransmitter by Otto Loewi, who initially gave it the name Vagusstoff because it was released from the vagus nerve. They jointly received the 1936 Nobel Prize in physiology or medicine for their work. Acetylcholine was also the first neurotransmitter to be identified.

Functions

Muscarinic acetylcholine receptor M2: This human M2 muscarinic acetylcholine receptor is bound to an antagonist (ACh).

Acetylcholine has functions both in the peripheral nervous system (PNS) and in the central nervous system (CNS) as a neuromodulator. In the peripheral nervous system, acetylcholine activates muscles and is a major neurotransmitter in the autonomic nervous system. In the central nervous system, acetylcholine and its associated neurons form the cholinergic system.

When acetylcholine binds to acetylcholine receptors on skeletal muscle fibers, it opens ligand-gated sodium channels in the cell membrane. Sodium ions then enter the muscle cell, initiating a sequence of steps that finally produce muscle contraction. Although acetylcholine induces contraction of skeletal muscle, it acts via a different type of receptor to inhibit the contraction of cardiac muscle fibers.

In the autonomic nervous system, acetylcholine is released in the following sites: all pre- and post-ganglionic parasympathetic neurons, all pre-ganglionic sympathetic neurons, some post-ganglionic sympathetic fibers, and in the pseudomotor neurons to sweat glands.

In the central nervous system, ACh has a variety of effects as a neuromodulator for plasticity, arousal, and reward. ACh has an important role in the enhancement of sensory perceptions when we wake up and in sustaining attention.

Damage to the cholinergic (acetylcholine-producing) system in the brain has been shown to be plausibly associated with the memory deficits associated with Alzheimer’s disease. ACh has also been shown to promote REM sleep.

In the cerebral cortex, tonic ACh inhibits layer 4 neurons, the main targets of thalamocortical inputs while exciting pyramidal cells in layers 2/3 and 5. This filters out weak sensory inputs in layer 4 and amplifies inputs that reach the layers 2/3 and layer 5 excitatory microcircuits.

As a result, these layer-specific effects of ACh might function to improve the signal-to-noise ratio of cortical processing. At the same time, acetylcholine acts through nicotinic receptors to excite certain groups of inhibitory interneurons in the cortex that further dampen cortical activity.

Nicotinic acetylcholine receptors: These schematics describe the heteromeric and homomeric nature of nAChRs. The heteromeric receptors found in the central nervous system are made up of 2 α and 3 β subunits with the binding site at the interface of α and adjacent subunit. Homomeric receptors contain 5 identical subunits and have 5 binding sites located at the interfaces between adjacent subunits.

One well-supported function of ACh in the cortex is an increased responsiveness to sensory stimuli, a form of attention. Phasic increases of ACh during visual, auditory, and somatosensory stimulus presentations have been found to increase the firing rate of neurons in the corresponding primary sensory cortices.

When cholinergic neurons in the basal forebrain are lesioned, animals’ ability to detect visual signals was robustly and persistently impaired. In that same study, an animals’ ability to correctly reject non-target trials was not impaired, further supporting the interpretation that phasic ACh facilitates responsiveness to stimuli.

ACh has been implicated in reporting expected uncertainty in the environment, based both on the suggested functions listed above and results recorded while subjects perform a behavioral cuing task. Reaction time differences between correctly cued trials and incorrectly cued trials, called the cue validity, was found to vary inversely with ACh levels in primates with pharmacologically and surgically altered levels of ACh. The result was also found in Alzheimer’s disease patients and smokers after nicotine (an ACh agonist) consumption.

Creation of ACh

Acetylcholine is synthesized in certain neurons by the enzyme choline acetyltransferase from the compounds choline and acetyl-CoA. Cholinergic neurons are capable of producing ACh.

An example of a central cholinergic area is the nucleus basalis of Meynert in the basal forebrain. The enzyme acetylcholinesterase converts acetylcholine into the inactive metabolites choline and acetate. This enzyme is abundant in the synaptic cleft, and its role in rapidly clearing free acetylcholine from the synapse is essential for proper muscle function.

Certain neurotoxins work by inhibiting acetylcholinesterase, leading to excess acetylcholine at the neuromuscular junction. This results in paralysis of the muscles needed for breathing and stops the beating of the heart.

Adrenergic Neurons and Receptors

Adrenergic receptors are molecules that bind catecholamines. Their activation leads to overall stimulatory and sympathomimetic responses.

Learning Objectives

Describe adrenergic neurons and receptors in the autonomic nervous system

Key Takeaways

Key Points

• Adrenergic receptors consist of two main groups, α and β, multiple subgroups (α1, α2, β1, β2, β3), and several subtypes of the α2 subgroup (α2A, α2B, α2C).
• Epinephrine binds both α and β adrenergic receptors to cause vasoconstriction and vasodilation.
• When activated, the α1 receptor triggers smooth muscle contraction in blood vessels in the skin, gastrointestinal tract, kidney, and brain, among other areas.
• When activated, the α2 receptor triggers inhibition of insulin and the induction of glucagon release in the pancreas, contraction of GI tract sphincters, and increased thrombocyte aggregation.
• When activated, the α2 receptor triggers inhibition of insulin and induction of glucagon release in the pancreas, contraction of GI tract sphincters, and increased thrombocyte aggregation.

Key Terms

• adrenoreceptor: These are a class of G protein-coupled receptors that are targets of the catecholamines, especially norepinephrine (noradrenaline) and epinephrine (adrenaline). Many cells possess these receptors, and the binding of a catecholamine to the receptor will generally stimulate the sympathetic nervous system.
• G protein-coupled receptors: These comprise a large protein family of transmembrane receptors that sense molecules outside the cell and activate inside signal transduction pathways and, ultimately, cellular responses. Any adrenergic effects on cells are generally mediated by G protein-coupled receptors.
• adrenergic receptor: Any of several sites in the surface membranes of cells innervated by adrenergic neurons.

The adrenergic receptors (or adrenoceptors) are a class of metabotropic G protein -coupled receptors that are targets of the catecholamines, especially norepinephrine or noradrenaline, and epinephrine ( adrenaline ). Although dopamine is a catecholamine, its receptors are in a different category.

Many cells possess these receptors, and the binding of an agonist will generally cause a sympathetic (or sympathomimetic) response (e.g., the fight-or-flight response). For instance, the heart rate will increase, pupils will dilate, energy will be mobilized, and blood flow will be diverted from non-essential organs to skeletal muscle.

Adrenaline (epinephrine): The 2D structure of adrenaline (epinephrine) is illustrated.

Noradrenaline (norepinephrine): The 2D structure of noradrenaline (norepinephrine) is illustrated here.

There are two main groups of adrenergic receptors, α and β, with several subtypes. α receptors have the subtypes α1 (a Gq coupled receptor) and α2 (a Gi coupled receptor). Phenylephrine is a selective agonist of the α receptor.

β-receptors have the subtypes β1, β2, and β3. All three are linked to Gs proteins (although β2 also couples to Gi), which in turn are linked to adenylate cyclase. Agonist binding thus causes a rise in the intracellular concentration of the second messenger cAMP. Downstream effectors of cAMP include the cAMP-dependent protein, kinase (PKA), which mediates some of the intracellular events following hormone binding. Isoprenaline is a nonselective agonist.

Adrenaline or noradrenaline are receptor ligands to α1, α2, or β-adrenergic receptors (the pathway is shown in the following diagram).

• α1 couples to Gq, which results in increased intracellular Ca2+ that results in smooth muscle contraction.
• α2, on the other hand, couples to Gi, which causes a decrease of cAMP activity, that results in smooth muscle contraction.
• β receptors couple to Gs, and increases intracellular cAMP activity, resulting in heart muscle contraction, smooth muscle relaxation, and glycogenolysis.

Adrenergic signal transduction: This schematic shows the mechanism of adrenergic receptors. Adrenaline and noradrenaline are ligands to α1, α2, or β-adrenergic receptors. α1-receptors couple to Gq, resulting in increased intracellular Ca2+ and causing smooth muscle contraction. α2 receptors couple to Gi, causing a decrease in cAMP activity and resulting in smooth muscle contraction. β-receptors couple to Gs, increasing intracellular cAMP activity and resulting in heart muscle contraction, smooth muscle relaxation, and glycogenolysis.

Adrenaline (epinephrine) reacts with both α- and β-adrenoceptors, causing vasoconstriction and vasodilation, respectively. Although α receptors are less sensitive to epinephrine, when activated, they override the vasodilation mediated by β-adrenoceptors. The result is that high levels of circulating epinephrine cause vasoconstriction. At lower levels of circulating epinephrine, β-adrenoceptor stimulation dominates, producing an overall vasodilation.

Smooth muscle behavior is variable depending on anatomical location. One important note is the differential effects of increased cAMP in smooth muscle compared to cardiac muscle. Increased cAMP will promote relaxation in smooth muscle, while promoting increased contractility and pulse rate in cardiac muscle.

α-receptors have several functions in common, but also individual effects. Common (or still unspecified) effects include: vasoconstriction of cardiac arteries (coronary artery), vasoconstriction of veins, and decreased motility of smooth muscle in the gastrointestinal tract.

α1-adrenergic receptors are members of the G protein-coupled receptor superfamily. On activation, a heterotrimeric G protein, Gq, activates phospholipase C (PLC).

The PLC cleaves phosphatidylinositol 4,5-bisphosphate (PIP2), which in turn causes an increase in inositol triphosphate (IP3) and diacylglycerol (DAG). The former interacts with calcium channels of the endoplasmic and sarcoplasmic reticulum, thus changing the calcium content in a cell. This triggers all other effects.

Specific actions of the α1-receptor mainly involve smooth muscle contraction. It causes vasoconstriction in many blood vessels, including those of the skin, gastrointestinal system, kidney (renal artery), and brain. Other areas of smooth muscle contraction are:

• Ureter.
• Vas deferens.
• Hair (arrector pili muscles).
• Uterus (when pregnant).
• Urethral sphincter.
• Bronchioles (although minor to the relaxing effect of β2 receptor on bronchioles).
• Blood vessels of ciliary body (stimulation causes mydriasis).

Further effects include glycogenolysis and gluconeogenesis from adipose tissue and the liver, as well as secretion from sweat glands, and Na+ reabsorption from kidney. Antagonists may be used in hypertension.

There are 3 highly homologous subtypes of α2 receptors: α2A, α2Β, and α2C.

α2-Receptor Effects

• Inhibition of insulin release in the pancreas.
• Induction of glucagon release from the pancreas.
• Contraction of sphincters of the gastrointestinal tract.
• Negative feedback in the neuronal synapses—presynaptic inhibition of noradrenalin release in CNS.

β1-Receptor Effects

• Increases cardiac output, by raising heart rate (positive chronotropic effect), increasing impulse conduction (positive dromotropic effect), and increasing contraction (positive inotropic effect), thus increasing the volume expelled with each beat (increased ejection fraction).
• Increases renin secretion from the juxtaglomerular cells of the kidney.
• Increases ghrelin secretion from the stomach.

β2-Receptor Effects

• Smooths muscle relaxation, e.g., in bronchi and the GI tract (decreased motility).
• Lipolysis in adipose tissue.
• Anabolism in skeletal muscle.
• Relaxes a non-pregnant uterus.
• Dilates arteries to skeletal muscle.
• Glycogenolysis and gluconeogenesis.
• Stimulates insulin secretion.
• Contracts the sphincters of the GI tract.
• Thickens secretions from the salivary glands.
• Inhibits histamine release from mast cells.
• Increases renin secretion from the kidney.
• Relaxation of bronchioles (salbutamol, a beta-2 agonist, relieves bronchiole constriction).

Agonists, Antagonists, and Drugs

Drugs effecting cholinergic neurotransmission may block, hinder, or mimic the action of acetylcholine and alter post-synaptic transmission.

Learning Objectives

Distinguish between the effects of an agonist versus an antagonist in the autonomic nervous system

Key Takeaways

Key Points

• Acetylcholine receptor agonists and antagonists have either direct effects on the receptors or act indirectly by affecting the enzyme acetylcholinesterase.
• Agents targeting ACh receptors may target either the nicotinic or muscarinic receptors for ACh.
• Atropine, an antagonist for muscarinic ACh receptors, lowers the parasympathetic activity of muscles and glands in the parasympathetic nervous system.
• Neostigmine is an indirect ACh receptor agonist that inhibits acetylcholinesterase, preventing the breakdown of acetylcholine. It is used in the treatment of myasthenia gravis and to reverse the effects of neuromuscular blockers used for anesthesia.
• Phenylephrine, marketed as a substitute for Sudafed for decongestant purposes, is an α1- adrenergic receptor agonist.
• Beta-blockers, as their name suggests, block the action of epinephrine and norepinephrine on β-adrenergic receptors and are used for the management of cardiac arrhythmias, cardio-protection after a heart attack, and hypertension.

Key Terms

• acetylcholinesterase: An enzyme that catalyzes the breakdown of the neurotransmitter acetylcholine.
• beta-blockers: Also called beta-adrenergic blocking agents, beta-adrenergic antagonists, beta-adrenoreceptor antagonists, or beta antagonists, these are a class of drugs used for various indications. As beta-adrenergic receptor antagonists, they diminish the effects of epinephrine (adrenaline) and other stress hormones.
• atropine: An alkaloid extracted from the plant deadly nightshade (Atropa belladonna) and other sources. It is used as a drug in medicine for its paralytic effects (e.g., in surgery to relax muscles, in dentistry to dry the mouth, in ophthalmology to dilate the pupils), though overdoses are fatal.

Blocking, hindering, or mimicking the action of acetylcholine has many uses in medicine. Drugs that act on the acetylcholine system are either agonists to the receptors that stimulate the system, or antagonists that inhibit it.

Acetylcholine receptor agonists and antagonists can have a direct effect on the receptors or exert their effects indirectly. For example, by affecting the enzyme acetylcholinesterase the receptor ligand is degraded. Agonists increase the level of receptor activation, antagonists reduce it.

Acetylcholine in the ANS

The vagus (parasympathetic) nerves that innervate the heart release acetylcholine (ACh) as their primary neurotransmitter. ACh binds to muscarinic receptors (M2) that are found principally on cells comprising the sinoatrial (SA) and atrioventricular (AV) nodes.

Muscarinic receptors are coupled to the G_i-protein; therefore, vagal activation decreases cAMP. G_i-protein activation also leads to the activation of KACh channels that increase potassium efflux and hyperpolarizes the cells.

Increases in vagal activity to the SA node decreases the firing rate of the pacemaker cells by decreasing the slope of the pacemaker potential and decreasing heart rate. By hyperpolarizing the cells, vagal activation increases the cell’s threshold for firing, which contributes to the reduction the firing rate.

Similar electrophysiological effects also occur at the atrioventricular AV node. However, in this tissue, these changes are manifested as a reduction in impulse conduction velocity through the AV node. In the resting state, there is a large degree of vagal tone on the heart, which is responsible for low, resting heart rates.

There is also some vagal innervation of the atrial muscle, and to a much lesser extent, the ventricular muscle. Vagus activation, therefore, results in modest reductions in atrial contractility (inotropy) and even smaller decreases in ventricular contractility.

Muscarinic Antagonists

Atropine: The 2D chemical structure of atropine is illustrated here.

Muscarinic receptor antagonists bind to muscarinic receptors, thereby preventing ACh from binding to and activating the receptor. By blocking the actions of ACh, muscarinic receptor antagonists very effectively block the effects of vagal nerve activity on the heart. By doing so, they increase heart rate and conduction velocity.

Atropine is a naturally occurring tropane alkaloid extracted from deadly nightshade (Atropa belladonna), Jimson weed (Datura stramonium), mandrake (Mandragora officinarum), and other plants of the family Solanaceae. Atropine’s pharmacological effects are due to its ability to bind to muscarinic acetylcholine receptors. It is an anti-muscarinic agent.

Working as a nonselective muscarinic acetylcholinergic antagonist, atropine increases firing of the sinoatrial node (SA) and conduction through the atrioventricular node (AV) of the heart, opposes the actions of the vagus nerve, blocks acetylcholine receptor sites, and decreases bronchial secretions. In overdoses, atropine is poisonous.

Nicotinic Agonists

A nicotinic agonist is a drug that mimics, in one way or another, the action of acetylcholine (ACh) at nicotinic acetylcholine receptors (nAChRs). Nicotinic acetylcholine receptors are receptors found in the central nervous system, the peripheral nervous systems, and skeletal muscles.

They are ligand-gated ion channels with binding sites for acetylcholine as well as other agonists. When agonists bind to a receptor it stabilizes the open state of the ion channel allowing an influx of cations.

Nicotinic acetylcholine receptors: NAchR are cholinergic receptors that form ligand-gated ion channels in the plasma membranes of certain neurons and on the postsynaptic side of the neuromuscular junction.

The development of nicotinic acetylcholine receptor agonists began in the early nineties after the discovery of nicotine’s positive effects on animal memory. Nicotinic antagonists are mainly used for peripheral muscle paralysis in surgery, the classical agent of this type being tubocurarine, but some centrally acting compounds such as bupropion, mecamylamine, and 18-methoxycoronaridine block nicotinic acetylcholine receptors in the brain and have been proposed for treating drug addiction.

The nicotinic acetylcholine receptor agonists are gaining increasing attention as drug candidates for multiple central nervous system disorders such as Alzheimer’s disease, schizophrenia, attention-deficit hyperactivity disorder (ADHD), and nicotine addiction. In 2009 there were at least five drugs on the market that affect the nicotinic acetylcholine receptors.

Most indirect-acting ACh receptor agonists work by inhibiting the enzyme acetylcholinesterase. The resulting accumulation of acetylcholine causes a continuous stimulation of the muscles, glands, and central nervous system.

They are examples of enzyme inhibitors, and increase the action of acetylcholine by delaying degradation; some have been used as nerve agents (sarin and VX nerve gas) or pesticides (organophosphates and the carbamates). In clinical use, they are administered to reverse the action of muscle relaxants, to treat myasthenia gravis, and to treat symptoms of Alzheimer’s disease (rivastigmine increases cholinergic activity in the brain).

Beta Receptor Antagonists

Beta blockers (sometimes written as β-blockers) or beta-adrenergic blocking agents, beta-adrenergic antagonists, beta-adrenoreceptor antagonists, or beta antagonists, are a class of drugs used for various indications. They are particularly used for the management of cardiac arrhythmias, cardiac protection after myocardial infarction (heart attack), and hypertension.

As beta-adrenergic receptor antagonists, they diminish the effects of epinephrine (adrenaline) and other stress hormones. Beta blockers block the action of endogenous catecholamines —epinephrine (adrenaline) and norepinephrine (noradrenaline) in particular—on β-adrenergic receptors, part of the sympathetic nervous system that mediates the fight-or-flight response.

Acetylcholine

Read:
3 535

Acetylcholine is one of the most abundant neurotransmitters in the human body. It is found in both the central nervous system and the peripheral nervous system. It is the neurotransmitter , which is important for the daily functioning of the brain, especially in the areas of movement, learning, memory and sleep quality.

Why is acetylcholine so important for the body? It has a number of critical functions, many of which can be compromised by diseases or drugs that interfere with the function of this neurotransmitter.

• Acetylcholine can be found in all motor neurons, where it stimulates muscle contraction. From the movements of the stomach and heart to the blinking of the eyelashes, all body movements involve the action of this important neurotransmitter.
• It is also found in many neurons in the brain and plays an important role in mental processes such as memory and cognition. Severe depletion of acetylcholine has been linked to autism, ADHD, anxiety, and Alzheimer’s disease.

What is Acetylcholine?

Acetylcholine is used by organisms in all walks of life for a variety of purposes.It is believed that choline , a precursor of acetylcholine, was used by unicellular organisms billions of years ago to create cell layers [1].

Acetylcholine is a neurotransmitter that is used for many purposes, from muscle stimulation to memory and sleep.

Acetylcholine is synthesized from acetyl-CoA (which comes from glucose) and choline using the enzyme choline acetyltransferase [2].

Acetylcholine controls movement by causing muscle contractions [3].Acetylcholine and histamine interact with each other to contract lung muscles [4].

In the brain, it participates in memory and attention [5, 6] and contributes to the sleep phase associated with sleep (REM sleep) [7].

Benefits of Acetylcholine

Acetylcholine Helps Improve and Preserve Memory

Too little acetylcholine in the brain’s memory center (hippocampus) has been associated with dementia and Alzheimer’s disease [8].

Scopolamine, a drug that blocks acetylcholine, prevents the acquisition of new information in humans and animals [9, 10].

In monkeys, impaired supply of acetylcholine to the brain (neocortex, hippocampus) interferes with obtaining factual information (discriminatory learning) and also causes oblivion comparable to amnesia in humans [11, 12].

In 1391 people, higher choline intake was associated with improved cognitive functions (verbal and visual memory) [13].

There is a link between acetylcholine and Alzheimer’s disease. It is estimated that the loss of acetylcholine in the brains of people suffering from Alzheimer’s disease is 90% [14].Medicines that increase acetylcholine are commonly used to treat Alzheimer’s disease [15].

Acetylcholine may improve memory by helping to encode new memories and increasing synapse modification [16].

In 24 men, taking choline (500-1000 mg, choline with CDP) improved various cognitive processes (including working memory and verbal memory), but only in people with low levels of cognitive functions (ie, less intelligent people) [17 ]. CDP choline works in part by increasing acetylcholine.

Acetylcholine can improve attention and concentration

Historically, it was believed that acetylcholine mainly plays an important role in learning and short-term memory functions. However, more recent studies have confirmed the role of acetylcholine in attention span [18].

In rats, acetylcholine helped improve attention and task performance [19].

Sixty healthy adult women aged 40–60 who took choline supplements (CDP-choline) for 28 days improved attention [20].

Acetylcholine is also important for the speed of the reaction [21].

Acetylcholine helps reduce inflammation

Acetylcholine has such a significant effect on reducing inflammation that it has a pathway named after it: “Cholinergic anti-inflammatory pathway” [22].

Inflammatory cytokines are produced by cells of the immune system during injuries and infections. They help initiate a cascade of effects that attract inflammatory cells to the site of infection in order to render it harmless and prevent further spread.

The cholinergic anti-inflammatory pathway has an inhibitory effect on the immune response, which protects the body from damage that can occur if the localized inflammatory response extends beyond local tissues, resulting in toxicity or damage to the kidneys, liver, lungs, and other organs [23] …

Activation of the vagus nerve has an anti-inflammatory effect via acetylcholine. In animals, elevated acetylcholine reduced inflammation of the intestinal mucosa (MHC II level and proinflammatory cytokines via α7nAChR).Acetylcholine has been shown to reduce IL-6, IL1B, TNF-a, and other pro-inflammatory cytokines in various inflammatory conditions, including intestinal inflammation [24].

Acetylcholine receptors (α7nAChR) are found on various immune cells (macrophages, monocytes and mast cells) and reduce inflammation by inhibiting their activation [24].

However, acetylcholine (via nAChR) also inhibits the production of the anti-inflammatory cytokine (IL-10).

Acetylcholine improves wakefulness

Acetylcholine is one of the main neurotransmitters responsible for wakefulness, in addition to orexin, histamine, norepinephrine and dopamine [25].

The release of acetylcholine increases during wakefulness [26].

In rats, sedatives and hypnotics (zolpidem, diazepam, and esopiclone) alter the release of acetylcholine [26].

Acetylcholine helps to sleep better

Acetylcholine promotes rapid sleep, which helps memory and the brain to recover [26].

Acetylcholine helps intestinal motility

Nicotine (via nicotinic acetylcholine receptors) helps “digestion”.

This is why when 1 in 6 people quit smoking, they become constipated [27].

In addition, antidepressants can inhibit this acetylcholine receptor, causing constipation as a side effect [28].

The part of the nervous system responsible for “rest and digestion” (parasympathetic) uses acetylcholine to induce these effects [29].

Acetylcholine helps relieve pain

Direct activation of choline receptors or an increase in acetylcholine reduces pain in rodents and humans, while blocking choline (muscarinic) receptors increases pain sensitivity [30].

Higher levels of acetylcholine in the spinal cord relieve pain, while decreased levels of acetylcholine or its activity (via receptor blockade) induce pain sensitivity [31].

Donepezil, a drug that increases acetylcholine, has a dose-dependent analgesic effect in humans, and is also effective as a prophylactic treatment for migraine headaches [32].

Activation of nicotinic receptors also has an analgesic effect in animal models in acute and chronic pain conditions [33].

Acetylcholine protects against infections

Acetylcholine can modulate inflammatory responses. It has been shown that acetylcholine has the ability to inhibit biofilm formation during fungal infection ( Candida albicans ) in an animal model of infection [34].

Acetylcholine improves blood flow

Acetylcholine through muscarinic receptors increases the production of nitric oxide in blood vessels, which leads to improved blood circulation (vasodilation) [35].

Acetylcholine and hormones

Acetylcholine affects the secretion of pituitary hormones by acting on the hypothalamus. It causes prolactin and growth hormone to be released from the pituitary gland [36, 35].

Adverse Effects of Acetylcholine

Depression

A link between smoking and depression has been reported in many studies. In chronic smokers, acetylcholine (nicotinic) receptors are increased rather than decreased, as is often the case with chronic substance use.The increase in these receptors and contribute to the association of depression and smoking [37].

Based on animal models, too much activation of certain acetylcholine receptors (α-alpha4beta2 or alpha7 nicotinic receptors) may contribute to depression [38, 39].

What Increases Acetylcholine

• Serotonin [40]
• Estrogen [41]

Acetylcholine Supplements

In order to increase your acetylcholine levels, you need to increase choline levels.Choline can be found in various foods such as eggs and liver.

Stronger additives:

• Bacopa
• Huperzine A
• Epimedium [43]
• Caffeine [44]
• Blueberries [45]
• Zinc [46]
• Copper [46]
• Grape Seed Extract [ 47]
• Rosemary
• Cinnamon [48]
• Basil [49]
• Gotu Kola [50]

Weaker additives:

• EGCG [51]
• Curcumin [52]
• Manganese in the presence of citrate enhances the synthesis of acetylcholine [53]
• DHA and dietary fish oils [54]
• Luteolin enhances choline, which in turn increases acetylcholine in the body [55]
• Quercetin (high dose) [56]
• Pho-ty popular herb in traditional Chinese medicine [57]
• Ashwagandha
• Saffron [58]
• Reishi [59]
• Oregano [60]
• Rhodiola [61]

900 13 Rehmannia / Catalpol [62]

• Noni [63]
• Ginkgo Biloba
• Mint
• Schisandra [65]
• Magnesium [66]
• Andrographis [67]
• Fenugreek [68]
• Melatonin [69]
• Ginger [70]
• Ginseng [71]
• Licorice [72]
• Sulforaphane [73]
• Ginseng [74]
• Propolis [75]
• Muira Puama [76]
• Insulin [77]
• Fasting [78]

Decreased Acetylcholine

Many drugs can inhibit acetylcholine by mimicking or inhibiting choline [79]

Acetylcholine, IQ 160 | CleverMindRu

Good day to all! What do we know about the brain and intellectual ability? Quite frankly, little, but what we know for sure is that there is a neurotransmitter that improves cognitive performance.If Darwin’s theory is correct, then he, with each generation will be produced in greater quantities, if a person does not degrade. The interest is that its level can be increased now, moreover, you can “play” with acetylcholine so that it develops first one and then another property of the brain. It will not make you happier, more energetic or calmer, but it will help you become a more intelligent Human than it was before, it will speed up the learning process, all other things being equal.

Acetylcholine is one of the first discovered neurotransmitters, it happened in the first half of the 20th century.

What is acetylcholine produced for?

He is responsible for intellectual abilities, as well as for neuromuscular communication, not only biceps, triceps, but also the autonomic nervous system, that is, for the muscles of the organs.

Large doses of acetylcholine “slow down” the body, “small” ones speed it up.

Begins to be more actively developed in a situation of obtaining new data or reproducing old ones.

Where and how is it produced

Acetylcholine is synthesized in axons, nerve terminals, this is the area where the end of one neuron adjoins another, from 2 substances:

1. From acetyl coenzyme A or CoA, which in turn appears from regular glucose (sugary foods).
2. From choline or vitamin B4, which is abundant in nuts and eggs, in the choline acetyltransferase reaction.

Then the acetylcholine in the neuron is packed into a kind of balls, containers, called vesicles, in the amount of about 10,000 molecules. And it goes to the end of the neuron in the presynaptic end. There, the vesicles merge with the cell membrane, and their contents fly out of the neuron into the synaptic cleft. Imagine an iron mesh, which is often pulled up instead of fences in small towns, and a small bag of water.We throw this bag into the net, it breaks, remains on the net, and the water flies on. The principle is similar: acetylcholine in vesicles, balls is directed to the end of the neuron, there the ball “breaks” inside, and the acetylcholine flew by.

Acetylcholine is either retained in the synaptic cleft, or enters another neuron, or returns back to the first. If it returns, then it is again collected in packages and about the fence)

How does it get into the second neuron?

Each neurotransmitter tends to its receptor on the surface of the 2nd neuron.Receptors are like doors, each door needs its own key, its own neurotransmitter. Acetylcholine has 2 types of keys, with which it opens 2 types of doors to another neuron: nicotinic and muscarinic.

Interesting point : The enzyme Acetylcholinesterase is responsible for the balance of acetylcholine in the synaptic cleft. When you gorge on some nootropic pills, acetylcholine rises, if its amount gets crazy, then this enzyme turns on. It breaks down “excess” acetylcholine into choline and acetate.

In Alzheimer’s patients (poor memory), this enzyme works at an increased speed, good results in their treatment are shown by drugs with temporary inhibition of the enzyme acetylcholinesterase. Inhibition means inhibition of the reaction, that is, drugs that inhibit the work of the enzyme that breaks down acetylcholine, roughly speaking, make you smarter . BUT !!! There is a huge BUT! Irreversible inhibition of this enzyme increases the concentration of acetylcholine too much, this is not good.

It causes convulsions, paralysis, even death. Irreversible acetylcholinesterase inhibitors are the majority of nerve gases. There is so much neurotransmitter that all muscles literally freeze, in a contracted position. If, for example, the bronchi are strongly narrowed, the person will suffocate. Well, now you know how paralyzing gases work.

Pros of acetylcholine:

– Improves the cognitive abilities of the brain, makes it smarter.

– Improves memory, helps in old age.

– Improves neuromuscular communication. It is useful in sports, due to the faster adaptation of the body to stress. It will indirectly force you to lift more weight or run a distance faster, through a quick adaptation to existing conditions.

– Acetylcholine is not stimulated by any drugs, but rather suppressed, there is no reason for abuse. To the greatest extent, acetylcholine is suppressed by hallucinogens. This is logical, for the occurrence of delirium, a dull brain is required.

– In general, a useful neurotransmitter for everyday quiet life.Helps to plan, less impulsive decisions and mistakes. Corresponds to the proverb “measure 7 times, cut once.”

Cons of acetylcholine:

– Harmful in stressful situations where you need to act.

– It inhibits the body when there is a lot of it. Look at the scientists, 90% calm and serene like boas. A dragon will fly by – they will not budge. But scientists are smart – and you can’t argue.

Amendment : people are different and the “sets” of neurotransmitters are different, if a person has a lot of acetylcholine and a lot of glutamate, then he will be faster and more decisive than the norm.And the intellectual potential will change slightly.

Exercise increasing acetylcholine in vivo:

– New information.

– Intellectual or physical training.

Acetylcholine increasing additives (agonists) :

– Racetams (piracetam, phenotropil, pramiracetam, aniracetam, oxiracetam …)

– Lecithin

– DMAE

– Choline

Acetyl30002 – Acetylcholine

– Huperzine

– Muscarin

– Medicines prescribed for Alzheimer’s disease

Acetylcholine-reducing additives (antagonists) :

– Atropoline –

– Atropol2 –

9000 search the English Wikipedia.

What to eat for a good level of acetylcholine: Eggs (I won’t get tired of repeating) and nuts.

Outcome:

1. Acetylcholine is not only a neurotransmitter of a good mind, but also an assistant in sports.
2. Produced in neurons from glucose and choline. Increase their level – increase POTENTIAL acetylcholine.
3. If there is too much of it, there will be paralysis, if too little, there will be inability to learn. Usually, without the most serious drugs, these extremes are almost impossible to get.Is that closer to old age – memory problems.
4. SuperMind, in theory, this is such an amount of acetylcholine that there is almost paralysis + good production of other neurotransmitters.
5. Eat well and develop, strain your brain and body, and you will have acetylcholine in quantities greater than 90% of your environment.

Good luck!

It was possible to clarify the mechanism of the effect of adrenaline on the transmission of nerve impulses

Muscle contraction is triggered by signals from neurons in the spinal cord.Impulses from a neuron to a muscle fiber are transmitted using neurotransmitters – special substances that are released at the point of contact between nerve and muscle cells. These include acetylcholine. Scientists previously knew that adrenaline affects the amount of acetylcholine released. In a new study, for the first time, it was found that the case may be not only in the amount of acetylcholine, but also in the nature of its release. The peculiarities of the action of adrenaline and its analogs must be taken into account both in their already widespread use in the clinic of heart and lung diseases, and in the development and introduction of new drugs for the treatment of neurodegenerative diseases, such as Alzheimer’s disease.

Acetylcholine is associated not only with the provision of physical activity, but also with the processes of memory, learning and concentration. So, with Alzheimer’s disease in patients, the level of acetylcholine decreases, while memory deteriorates up to the complete destruction of the patient’s personality. For many neurodegenerative diseases, drugs have been found, if not completely curing, then at least supporting the patient’s condition. One of the groups of such substances are drugs based on adrenaline.This hormone and its analogue norepinephrine, synthesized in the body, are involved in the nervous system’s response to stress, providing an increase in human performance. Adrenaline can affect the release of acetylcholine, which means it can improve the transmission of nerve signals, but the exact mechanism of this phenomenon is not known.

To gain a deeper understanding of the cellular and molecular mechanisms of the effect of adrenaline on the release of acetylcholine, scientists conducted an experiment. In a special solution to maintain vital functions, they placed the soleus muscle of the hind limb of a laboratory rat with a nerve suitable for it.They then added adrenaline and monitored the release of acetylcholine by altering the electrical responses that occur at the point of contact between the end of the nerve and the muscle cell. In response to a nerve stimulus, acetylcholine is released in the form of a “bundle” from several tens to hundreds of small portions, which are called quanta. If the release of these portions occurs asynchronously, then the arising electrical signal in the muscle may not cause its contraction and disrupt motor activity. It turned out that under the action of adrenaline, the quanta of acetylcholine began to be released more synchronously, that is, the “bundles” became more compact and capable of generating an electrical response of greater amplitude in the muscle, which would more easily cause muscle contraction.Since the degree of synchronicity of the release of quanta of acetylcholine depends on the amount of calcium ions entering the nerve ending from the extracellular environment, it can be assumed that the action of adrenaline, which facilitates signal transmission from the nerve to the muscle, is associated with a change in intracellular calcium-dependent processes.

“Our laboratory studies the processes occurring in the motor nerve / muscle system. Our studies have shown that the effectiveness, direction and mechanisms of action of adrenaline and norepinephrine depend on the type of animal, type of muscle and its functional activity.This may be due to the existence of different types of receptors that bind adrenaline and norepinephrine, and different processes that develop in a living cell after activation of these receptors, ”explains Professor Elya Bukharaeva , Leading Researcher, Laboratory of Biophysics of Synaptic Processes, Kazan Institute Biochemistry and Biophysics of the Federal Research Center of the Russian Academy of Sciences.

Presynaptic regulation of the size of the acetylcholine quantum in motor synapses – R&D

Acetylcholine boost NOW DMAE 250 mg (100 caps)

😊 99% positive feedback 🚀 Fast delivery in Ukraine

🔥 Always affordable prices 💜 We respect our customers

Dimethylaminoethanol) increases the level of active acetylcholine, which tones the brain and improves skin condition.

Skin aging is characterized by many changes, including wrinkles, discoloration, blemishes, ruptured blood vessels, and loss of shine.However, the face betrays age not only because of the changes that occur on the surface of the skin. On the chin, on the nose and along the jaw line, the skin itself begins to sag.

Why do muscles sag? When you tense a muscle in your arm or make your facial muscles smile, a signal is sent along the nerves (the process is very similar to the functioning of an electric wire) to the very muscle tissue that should work. At the very tip of the nerve there is a thickening where, like in a reservoir, chemicals accumulate.Among them is acetylcholine. Whenever a certain amount of acetylcholine enters the muscle tissue, it responds with increased tone or movement. Like all other systems in the body, the nervous system is also aging due to the incessant harmful effects of free radicals and insufficient optimal nutrition. As aging begins, both the amount of acetylcholine produced and its effect on the muscles decrease. The only way to reverse this process (which means getting a stronger muscle response and tighter skin) is to increase the level of active acetylcholine in the body, which can be achieved by better nutrition and application of DMAE both externally and internally.As a result, both general well-being and the nutritional environment of the skin will improve.

How does DMAE help? DMAE increases the levels of chemicals in the central nervous system that help us think clearly. Millions of people take DMAE capsules simply to enhance cognition. Despite the fact that DMAE is considered to be a very effective protection against the aging process, few people consider this substance as an antioxidant. However, if we move away from conventional thinking, DMAE acts precisely as an antioxidant, since it helps to stabilize cell membranes: it protects them from damage caused by free radicals, by helping cells to get rid of waste products and retain valuable nutrients.When applied, this not too common nutritional complex not only acts quickly, but also strengthens the skin for a long time. Besides, there is nothing safer.

DMAE is considered an integral part of food, so you can take it without any harm.

If you add alpha-lipoic acid and Ester C to DMAE, you can fight any sign of aging and, if not completely, then to a large extent, remove the inevitable fine lines, wrinkles from the face, restore the skin to a healthy color and lost elasticity.Unfortunately, age-related changes cannot be avoided, but they can be successfully treated without side effects, allergic reactions, surgery or pain.

Direct action of DMAE:
– Cardiovascular diseases.
– Impaired function of the brain, cerebral circulation.
– Fading skin, wrinkles.

NOW Foods DMAE (DMAE / Dimethylaminoethanol) has a unique effect on the skin: it is able to smooth wrinkles, give skin elasticity and restore radiant healthy color.This complex, entirely composed of natural ingredients, was initially considered one of the most effective remedies for fighting only internal aging of the body, but the effect of a noticeable external rejuvenation from its external use was soon noted. This gave a huge impetus to the development of a new generation of anti-aging cosmetic preparations: today the unique properties of dimethylaminoethanol are being actively studied not only abroad, but also in Russia. The effect produced by DMAE is due to the action of the strongest antioxidants that make up its composition.

Aging catalyst – the oxidative process – is significantly accelerated due to the harmful effects of the external environment, which causes lethargy, fatigue, depression, delayed reaction, difficulty in making decisions and irritability. Especially well aware of this is the inhabitants of large cities, who every day experience all the “delights” of existence in a metropolis. If you eat right, do not have bad habits and in general can serve as a standard of a healthy lifestyle, you still walk on the sidewalk every day and breathe in the polluted air, spend 30-40 minutes a day in the subway, where the influence of electromagnetic fields is very high, or in public transport, where you are facing a very real opportunity to catch some viral disease from a neighbor with a cold.

Even if you do not smoke, there will certainly be someone on the street or in a cafe near you with a cigarette. Improper nutrition, chronic stress, polluted air and water, various toxic chemicals entering our body contribute to serious circulatory disorders, therefore, brain tissues do not receive the necessary nutrition. The brain needs the extra help it can get (DMAE / Dimethylaminoethanol) to protect brain cells from damage, preserve their function, improve memory and the ability to process information.

When taken internally, NOW Foods DMAE (DMAE / Dimethylaminoethanol) has a positive effect on lipid metabolism in the body, enhancing the synthesis of phospholipids in the brain and liver; produces a rejuvenating effect directly on the central nervous system, contributing to the restoration of nerve cells. The pronounced antioxidant effect of this substance is manifested in the fact that it protects cells from damage by the most dangerous types of free radicals.

DMAE has a beneficial effect on the state of the blood – it begins to more actively capture oxygen and deliver it to the cells of body tissues.Blood circulation begins to normalize, an improvement in oxygen supply to the brain gradually increases the speed of its work: memory increases, concentration of attention and assimilation of educational material improves, general psychological mood increases, sleep normalizes. This complex rejuvenates and restores nerve cells, thereby activating all brain functions: absent-mindedness disappears, the ability to concentrate appears, and memory and understanding of the assimilated material improves, which can be very useful during periods of intensive study or exams.

DMAE also has a direct anti-aging effect on the central nervous system. In addition, DMAE is recommended for use by athletes, since for all its effectiveness it is not doping. Completely natural, it does not cause addiction, addiction or withdrawal.

DMAE removes lipofuscin from cells, an aging pigment that determines the age and appearance of the skin. However, lipofuscin can accumulate not only in the skin, but also in all tissues of the body (in the cells of the brain, heart, even directly in the cells of the central nervous system).Over time, it can fill the cell by almost a third, and if earlier scientists believed that this pigment was just cellular debris, then further research showed that lipofuscin is not at all so harmless: as it accumulates, it can poison the cell. DMAE from NOW Foods (DMAE / Dimethylaminoethanol) in a period of several months to two years is able to remove from our cells more than half of the lipofuscin accumulated throughout life, therefore it is recommended to start using drugs based on DMAE at a young age, until the body cells have accumulated a solid baggage of this pigment.

The main ability of DMAE to increase the activity and speed of nervous processes, mental and physical performance. The action is based on the ability to increase the content of choline in the brain and peripheral nervous structures, which leads to an increase in the activity of cholinergic structures. At the same time, the speed of the nerve impulse along the nerve trunks increases, and the synthesis of acetylcholine is enhanced. Dimethylaminoethanol (DMAE) has a highly beneficial effect on lipid metabolism, enhancing the synthesis of brain phospholipids, which form the basis of nerve cell walls.There has been a significant improvement in brain activity against the background of dimethylaminoethanol (DMAE): improved memory, attention, mental performance. This component reduces the content of lipofuscin (“aging pigment”) in brain cells, improves cognitive functions, enhances intelligence, memory, and learning. This compound is a free radical inhibitor (has an antioxidant effect) and protects cells from oxygen starvation. Has a moderate stimulating effect on the central nervous system, activating metabolic processes in it, improves the transmission of impulses in the hypothalamic and other areas of the brain.Strengthens the production of energy by the brain (stimulates the consumption of glucose, etc.).

DMAE is widely and with great success used by doctors to activate mental functions, improve mood. It is prescribed for hypochondriacal and asthenohypochondriac states, for disorders of mnestic functions in old and senile age, for traumatic and vascular diseases of the brain, for obsessive neuroses and other neurotic conditions. The effect has been proven in diencephalic syndrome, cerebrovascular accidents, and amyotrophic lateral syndrome.

Nutrient content per serving (1 capsule) of product:

DMAE / DMAE (dimethylaminoethanol) – 250 mg

Other ingredients:
Cellulose (capsules), magnesium stearate (vegetable source) rice flour and silica …

Contains no sugar, yeast, corn, soy, wheat, gluten, milk or preservatives.

Recommended Use:
As a dietary supplement, take 1 capsule 1 to 3 times daily, preferably between meals.Do not exceed dosage.

. Buy only high-quality sports nutrition and accessories in Kharkov with delivery across Ukraine in the EXFIT online store

Two messages about the possible effect of tea and caffeine extracts on aging processes and Alzheimer’s disease

Message 1. Green, white, black tea and Alzheimer’s disease

In 2034, 5% of the global population is predicted to be 85 years of age or older, inevitably leading to an increase in age-related disorders such as Alzheimer’s.Recent research by British scientists has shown that regular tea consumption reduces the risk of developing dementia in the elderly and developing Alzheimer’s disease. Scientists from the Center for Medicinal Plants at the University of Newcastle (UK) found that tea blocks the destruction of acetylcholine, which serves as a transmitter of signals between nerve cells. It is a decrease in the level of this substance in the brain that leads to age-related memory impairment and the development of Alzheimer’s disease.

For example, it has been reported that green tea ( Camellia sinensis ) has numerous health-enhancing properties and could potentially be beneficial for those suffering from Alzheimer’s disease and a number of other diseases, including cardiovascular disease and cancer.The Okello study found that both white and green tea extracts contain acetylcholinesterase inhibitors.

Studies have shown that both black and green tea act in almost the same way, but unlike black tea, green blocks not two, but three enzymes that destroy acetylcholine. If laboratory tests are confirmed, then by drinking 5-10 cups of tea daily, it will be possible to restore the level of acetylcholine and prevent premature aging of the brain.

British scientists seem to have found an excuse for tea lovers.Recent studies have shown that tea can slow down age-related changes in the brain, preventing memory impairment and the development of dementia, including Alzheimer’s disease. Both black and green tea have these properties.

Scientists led by Ed Okello, based at the Center for Medicinal Plants at the University of Newcastle, UK, found that tea blocks the breakdown of a substance called acetylcholine, which serves as a transmitter of signals between nerve cells.

Although the causes of Alzheimer’s disease are not yet fully understood by scientists, it is known that such patients have a dramatically reduced level of acetylcholine in the brain. The action of modern drugs is based on increasing the level of acetycholine to normal. Age-related memory impairment is also associated with a drop in acetylcholine levels.

Tea maintains adequate levels of acetylcholine in the brain of a healthy young person. At the same time, both the black and green varieties of the drink work according to the same principle, but unlike black green tea, it blocks not two, but three enzymes that destroy acetylcholine, and its effect, according to Dr. Okello, lasts longer.”If our research pays off in life, and not just in the laboratory,” says the researcher, “5-10 cups daily will be enough to restore acetylcholine levels and prevent premature aging of the brain.” Scientists believe they have shown the effects of many metabolites, however, further research is required to determine their potential bioaccumulation.

Official source:

http://www.ncbi.nlm.nih.gov/pubmed/22418730

Okello EJ, Leylabi R, McDougall GJ.Inhibition of acetylcholinesterase by green and white tea and their simulated intestinal metabolites // Food Funct. 2012 Jun; 3 (6): 651-61. doi: 10.1039 / c2fo10174b.

Report 2. Caffeine and Alzheimer’s Disease

An international team of scientists has shown for the first time that caffeine can inhibit the development of complexes of overphosphorylated tau proteins, the presence of which is a hallmark of Alzheimer’s disease. The results of the two-year study, published in the journal Neurobiology of Aging , may lead to the creation of a new class of drugs for the treatment of this disease.

Caffeine, which is part of coffee, tea, cocoa, acts as an antagonist of adenosine receptors in the brain: it binds to them and thereby reduces the effect of their work. Adenosine reduces the processes of excitation in the brain, and replacing it with caffeine, on the contrary, leads to a stimulating effect.

Previous research by scientists has shown that blocking the adenosine receptor subtype A2A plays an important role in slowing the progression of Alzheimer’s disease. Based on this data, researchers at the University of Bonn in Germany and the University of Lille in France have isolated an ultrapure, water-soluble substance that acts as an A2A receptor antagonist.This compound was found to be more effective and had fewer side effects than caffeine, as it selectively blocked only adenosine receptors of the A2A subtype.

For several weeks, mice with a genetic mutation that promotes the formation of tau complexes in the brain and the early development of Alzheimer’s disease were injected with an A2A receptor antagonist. Compared to the placebo control group, the animals in the experimental group performed significantly better on memory tests, thereby demonstrating a slowdown in cognitive decline.Histological analysis of the hippocampus, which is responsible for the transition of short-term memory to long-term memory, confirmed an improvement in the brain state of animals from the experimental group.

Scientists now plan to expand their research to other animal models of Alzheimer’s disease. If the results are confirmed, the researchers will conduct clinical trials of a caffeine-like substance that could lead to the development of a new class of drugs for the treatment of Alzheimer’s dementia in the future.

Official source:

http://www.neurobiologyofaging.org/article/S0197-4580%2814%24-X/abstract

Authors: Cyril Laurent, Sabiha Eddarkaoui, Maxime Derisbourg, Antoine Leboucher, Dominique Demeyer, Sébastien Carrier, Marion Schneider, Malika Hamdane, Christa E. Müller, Luc Buée, David Blum

Beneficial effects of caffeine in a transgenic model of Alzheimer’s Disease-like Tau pathology // Received 21 August 2013; received in revised form 9 March 2014; accepted on 23 March 2014.published online 31 March 2014. Accepted Manuscript

Modern management of patients with cognitive impairments :: DIFFICULT PATIENT

P.R. Kamchatnov, A.V. Chugunov, A.Yu. Kazakov
Russian State Medical University, Moscow

The management of a patient with cognitive impairments includes a number of main areas: the earliest possible detection of existing disorders and the establishment of the degree of their prognostic significance, the establishment of the most significant pathogenetic mechanism of the identified disorders and the determination of the optimal method for correcting existing disorders, the selection of a drug (complex of drugs) that maximizes the ability to correct existing violations.The goals of the therapy are to reduce the severity of cognitive deficits, slow down the rate of progression of the disease, and improve the patient’s quality of life. An important factor that largely determines the effectiveness of treatment is the establishment of contact with the patient or with representatives of his environment, providing the patient with daily assistance. An understanding of the complexity of the situation that has arisen and the need for systematic long-term treatment should be achieved. In this case, the nature and severity of unwanted side effects arising in the course of treatment, as well as the possibility of the simultaneous use of other drugs (low risk of drug interaction), are of exceptional importance.

Taking into account the modern understanding of the mechanisms of the formation of cognitive impairments, it seems necessary to emphasize the role of non-drug treatment methods. The highest level of intellectual workload is associated with lower rates of cognitive deficit progression. There is also evidence that systematic physical activity, various options for providing an influx of sensory stimulation, as well as factors such as a rational low-calorie diet enriched with polyunsaturated fatty acids and natural antioxidants, the provision of positive emotions and certain genetic characteristics of an individual can delay the onset of pronounced cognitive impairments. and slow the rate of progression of the disease.
Natural aging processes, the course of which is aggravated by concomitant degenerative, vascular and other diseases, are largely associated with impaired synthesis and release of neurotransmitters and changes in the structure of neuronal membranes. The mechanisms of interneuronal interaction suffer greatly. That is why of exceptional interest is the possibility of providing a stimulating effect on the work of cholinergic neurons, ensuring the plasticity of cell membranes, and maintaining a sufficient level of cerebral perfusion.
For this purpose, drugs are widely used to compensate for the deficiency of acetylcholine in the central nervous system, prevent the damaging effect of glutamatergic neurotransmission, the pathogenic effects of oxidative stress, and a decrease in cerebral perfusion due to various reasons.
One of the drugs with a number of these properties is choline alfoscerate (L-alpha glycerylphosphorylcholine) – Cereton. The drug takes an active part in a wide range of functions of the central nervous system.A fundamentally important property of choline alfoscerate is its ability to penetrate the blood-brain barrier, being metabolized precisely in the brain tissue, but in peripheral organs, in particular, in the muscles and liver. After being introduced into the body, due to the action of a number of enzymes, choline alfoscerate is split into choline and glycerophosphate, while their release occurs directly in the brain tissue.
Having undergone catabolic processes, the formed choline takes part in the synthesis of acetylcholine – one of the main mediators that ensure the transmission of signals between neurons in the central nervous system.It should be noted that it is acetylcholine that is currently considered as the main neurotransmitter providing the realization of cognitive functions. The synthesis of acetylcholine occurs in the presynaptic structures (terminals) of cholinergic neurons of the central nervous system.
In addition, it should be noted that in addition to direct participation in a complex sequence of biochemical reactions, including the formation of neurotransmitters, choline alfoscerate is directly related to the synthesis of a number of hormones, in particular, growth hormone.A series of experimental studies have demonstrated that choline alfoscerate has the ability to stimulate the release of acetylcholine from presynaptic terminals in vivo.
In turn, one of the components of the drug under consideration, glycerophosphate, is a precursor of phosphatidylcholine, a key component of the neuron membrane, which is a phospholipid in its chemical structure. Its significance is determined by the formation of a hydrophobic layer of the cell membrane, which ensures its dielectric properties.It was found that the positive effect of choline alfoscerate on the structure of membranes of neurons and cell organelles, plasticity and function of receptors improves the exchange of information between neurons, facilitates synaptic neurotransmission. The information available to date suggests that, by its pharmacological properties, choline alfoscerate is a powerful central cholinomimetic, the effects of which are realized in specific (cholinergic) structures of the brain.
It should also be noted that, in accordance with modern concepts, in the formation of cognitive, behavioral and functional disorders that occur in Alzheimer’s disease and some other types of dementia, there are disorders in the metabolism of acetylcholine in the brain. It was found that characteristic morphological findings are a decrease in the number of cholinergic neurons located in the basal nucleus of Meinert, as well as the death of cholinergic nerve cells in other parts of the brain.
The results of a series of experimental studies carried out in vivo indicate that, when choline is administered to the body, alfoscerate has a complex effect on the metabolism and functioning of certain parts of the central nervous system. It was found that when choline alfoscerate was administered to Sprague-Dawley rats at a daily dose of 100 mg / kg of body weight over a long period of time, a significant structural reorganization of the brain tissue of experimental animals was found.The most pronounced changes were found in the hippocampus and dentate groove. Histological examination, first of all, revealed a significantly increased branching of the processes of nerve cells, expressed to a much greater extent than in the control group. These changes can be unambiguously regarded as manifestations of the implementation of neuroplasticity processes – the ability of neurons to undergo structural and functional changes. It is due to the course of these processes that the acquisition of new skills and the restoration of impaired functions are possible.
Based on the results of experimental studies carried out on models of degenerative lesions of the central nervous system in elderly animals, it was found that three months of use of choline alfoscerate was accompanied by significantly less death of hippocampal neurons (in particular, in zones CA1, CA3 and the dentate nucleus) – the number of cells in young and old animals turned out to be almost identical. It is noteworthy that in animals of the control group that did not receive treatment, a decrease in the number of neurons was recorded, and they also more often showed signs of degenerative damage.
Clinically interesting are the results of experimental studies of the effects of choline alfoscerate, which served as the basis for clinical trials of the drug. Considerable experience has already been accumulated in the clinical use of the drug. So, the results of his clinical studies made it possible to establish that choline alfoscerate is a drug that increases the efficiency of mental activity. It was found that the drug is able to reduce the severity of memory impairment caused by the use of appropriate medications, and also provides an increase in the ability to concentrate, which is convincingly demonstrated by the results of the performance of a specifically sensitive battery of neuropsychological tests.
In a clinical respect, extremely valuable results were obtained when studying the possibility of using choline alfoscerate in patients with cognitive impairments of various origins. In a multicenter, randomized, double-blind study, the efficacy of choline alfoscerate (400 mg 3 times a day for 180 days) and placebo were evaluated. In accordance with the study design, the state of cognitive functions was assessed using a complex of neuropsychological methods, including the Alzheimer’s Disease Assessment Scale (ADAS), which allows to establish the state of cognitive functions (ADAS-Cog), behavior (ADAS-Behav), Mini-Mental State Examination (MMSE), Clinical Global Impression (CGI).A total of 261 patients were included in the study (132 received choline alfoscerate, 129 – placebo) aged 60-80 years (on average – 72.2 ± 7.5 years).
As a result of the study, it was found that during the observation period, which amounted to 90 and 180 days of drug use, respectively, cognitive functions were more preserved in patients receiving choline alfoscerate, while all the differences compared with the control group were significant. An important result of the study was the statement that the drug was well tolerated and that the frequency of undesirable side effects of the treatment was low.The results obtained allowed the authors of the study to recommend the use of choline alfoscerate for the treatment of patients with Alzheimer’s disease.
It is also of interest that similar results were obtained when studying the effectiveness of the use of choline alfoscerate in a less homogeneous population of patients (the study included patients with both Alzheimer’s disease and other forms of dementia, in particular, vascular). The design of the cited study was in the nature of a multicenter open comparative (the effectiveness of choline alfoscerate was compared with cytosine diphosphocholine, which has the ability to affect brain metabolism).In accordance with the protocol, cognitive functions (modified Parkside test, Sandoz geriatric scale, Wechsler test subtests), emotional status (Hamilton depression scale) were assessed. As a result of the study, data on a sufficiently high efficacy of the drug were confirmed, while its tolerance turned out to be very good.
Studies have been carried out on numerous occasions to study the effectiveness of the use of choline alfoscerate in patients with other (not caused by neurodegenerative lesions) forms of dementia.The efficacy of the drug in patients with vascular dementia of mild and moderate severity was studied in an open study (a total of 120 patients were included) who received choline alfoscerate 1 g per day intramuscularly for 90 days. Based on the statistical processing of the data obtained, it was found that the drug is able not only to slow down the progression of the pathological process, but also to provide a significant increase in the studied indicators characterizing the cognitive functions of patients and their emotional state.It seems important that there are differences that were significant both in comparison with the initial level and when compared with the comparison group.
An important result of the cited studies was the establishment of the high efficacy of the drug in the correction of cognitive disorders of various origins. A promising area of ​​application of the drug is the rehabilitation treatment of patients who have suffered an acute violation of cerebral circulation (ischemic or hemorrhagic stroke), other structural lesions of the central nervous system (trauma, neoplasms, etc.).). In this situation, the activation of the processes of plasticity of the nervous system under the influence of the drug is of particular value, in particular, the formation of new interneuronal connections.
One of the largest studies investigating the possibility of the clinical use of choline alfoscerate included 2,044 patients with acute ischemic stroke or transient ischemic attack. The cited study had an open multicenter design, choline alfoscerate was injected intramuscularly at 1,000 mg per day for 4 weeks, then the drug was prescribed at 400 mg 3 times a day for 5 months.To assess the state of cognitive functions and mental status of patients, standard validated questionnaires were used: MMSE, Mathew Scale, Crichton Rating Scale (CRS), Global Deterioration Scale (GDS).
As a result of the study, the authors found that the increase in values ​​on the MMSE scale after 4 weeks of treatment was 15.9 points (from 58.7 to 74.6 points), and the differences compared to the initial level were significant (p In addition , there is evidence that Cereton has a positive effect on the state of cerebral blood flow, thereby promoting the activation of metabolic processes in the brain and the activation of the reticular formation.Information about an increase in the blood flow velocity was obtained during dynamic observation of a group of patients with traumatic brain injury, in whom, in the process of using choline alfoscerate, the blood flow velocity in the middle cerebral arteries increased.
In the course of the study, special attention was paid to identifying the side effects of the use of choline alfoscerate. It turned out that side effects occurred in 44 patients, which amounted to 2.14% of the total number of those included in the study, while 14 patients (0.7%) had to stop treatment.The most frequent were palpitations (0.7%), nausea and vomiting (0.2%), headache (0.2%), nighttime sleep disturbances and psychomotor agitation (0.4%). The results of the study allowed the authors to recommend choline alfoscerate as a therapy for patients after an episode of acute cerebral ischemia. As in the course of most other clinical studies conducted, the high safety of the drug and its good tolerance have been confirmed.
A number of clinical trials carried out, in particular the design of incomparable short-term non-randomized ones, have confirmed the efficacy of Cereton in patients with cognitive decline, with the maximum effect recorded in patients with early forms of the disease, which are manifested by minimal cognitive impairment.
In general, the results of clinical trials of the effectiveness of the use of choline alfoscerate in patients with cognitive disorders of various origins were analyzed in the work of L. Parnetti et al. (2001). The analysis involved the results of 13 randomized clinical trials, which included a total of 4,054 patients with various forms of cognitive decline (vascular, Alzheimer’s type, senile), as well as acute cerebrovascular accidents (TIA, ischemic stroke).The results of studies examining the use of the drug in patients with dementia have convincingly demonstrated a significantly greater efficacy of choline alfoscerate compared with placebo. The effectiveness of the drug in acute cerebral ischemia was evaluated in a sample of 2,484 patients. It was found that a more complete and rapid recovery of lost neurological functions took place among patients treated with choline alfoscerate.
Studies carried out in the Russian Federation are also devoted to the study of the possibility of using choline alfoscerate in patients with various lesions of the central nervous system.Thus, the effectiveness of the drug used to correct the consequences of acute cerebral ischemia in a laboratory experiment was confirmed. The expediency of using the drug in patients with acute cerebral ischemia both at the stage of early lesions of the central nervous system and at the stage of rehabilitation treatment in patients requiring intensive therapy after surgical treatment for the removal of tumors of the posterior cranial fossa has been repeatedly emphasized. The expediency of using the drug in patients with neurodegenerative diseases, in particular, with Alzheimer’s disease, has been repeatedly noted.
In recent years, a series of studies on the effectiveness of the use of choline alfoscerate (Cereton, ZAO PharmFirma Sotex) in patients with various forms of cerebrovascular pathology and neurodegenerative diseases have been carried out in a number of clinics in the Russian Federation. As a result of the studies, the effectiveness of the drug was confirmed, its good tolerance was established.
Clinical study of Tsereton, conducted in an outpatient medical care setting in Moscow (T.Batysheva et al., 2009) made it possible to establish that even a short-term use of the drug in the form of intramuscular injections leads to a reliable positive dynamics of indicators of cognitive functions, and the achieved effect persists for a certain period of time.
It should also be noted that choline alfoscerate has good bioavailability, easily penetrates the blood-brain barrier, 85% of the drug introduced into the body is excreted by the lungs in the form of carbon dioxide, the rest (15%) is excreted by the kidneys and through the intestines.In acute conditions (acute stroke, traumatic brain injury) Cereton is administered intramuscularly or intravenously (slowly) at 1,000 mg per day in the morning for 15-20 days.
Contraindications for use are hypersensitivity to the drug; pregnancy; breast-feeding. It is not recommended to use during pregnancy and lactation, although special studies have shown the absence of embryotoxic or teratogenic activity of the drug. No established interactions with other drugs or food products have been found.
Thus, the published research results indicate that choline alfoscerate (Cereton) can be used to treat patients with cognitive disorders of various origins, in particular, in patients with cerebrovascular disorders and with acute traumatic brain injury. It should be emphasized that the use of the drug is associated with a decrease in the severity of neurological deficits, cognitive impairments and leads to an earlier recovery of neurological functions.

Recommended reading
1. OV Bykova, AN Boyko. Modern directions of neuroprotection: analysis of the experience of using choline alfoscerate in the complex therapy of acute cerebrovascular diseases // Farmateka. Neurology. Psychiatry. Pediatrics. 2005; 9: 104: 44-48.
2. Gavrilova S.I., Zharikov G.A. Treatment of Alzheimer’s disease // Psychiatry and psychopharmacology. 2001; 3: 2: 8-15.
3. Daminov V.D., Germanovich V.V. The use of Gliatilin in the complex treatment of patients with traumatic brain injury // Pharmateka (Cardiology, Neurology).2007; 15: 149: 70-73.
4. Melnikova E.V. Multifactorial neuroprotection in acute and chronic cerebrovascular accident (clinical and experimental study). Diss. St. Petersburg: 2007.
5. Fokin M.S., Savin I.A., Gorshkov K.M. et al. Intensive therapy in the early postoperative period in patients with tumors of the posterior cranial fossa. A guide for doctors. Second edition, supplemented. RMAPO, NIINH them. acad. N.N. Burdenko RAMS. Moscow: 2004.
6. Abbati C. Nootropic therapy of cerebral aging.Advances in Therapy // 1991; 8: 6: 268-276.
7. Amenta F. The cholinergic approach for the treatment of vascular dementia: evidence from preclinical and clinical studies // Clin Exp Hypertens. 2002; 24: 7-8: 697-713.
8. Barbagallo G., Barbagallo M., Giordano M. et al. alpha-Glycerophosphocholine in the mental recovery of cerebral ischemic attacks. An Italian multicenter clinical trial // Ann N Y Acad Sci. 1994; 30: 717: 253-269.
9. Bronzetti E., Felici L., Zaccheo D., Amenta F. Age-related anatomical changes in the rat hippocampus: retardation by choline alfoscerate treatment // Arch Gerontol Geriatr.1991; 13: 2: 167-178.
10. Bronzetti E., Collier W., Felic L. et al. Long-term choline alfoscerate treatment counteracts age-dependent structural changes in the rat hippocampus // Drug Development Research. 2004; 26: 4: 449-459.
11. Canal N., Franceschi M., Alberoni M. et al. Effect of L-alpha-glyceryl-phosphorylcholine on amnesia caused by scopolamine // Int J Clin Pharmacol Ther Toxicol. 1991; 29: 3: 103-107.
12. Ceda G. GH responses to GHRH in old subjects and in patients with senile dementia of the Alzheimer’s type: the effects of an acetylcholine precursor // Advances in the Biosciences.1993; 87: 425-428.
13. De Jesus Moreno Moreno M. Cognitive improvement in mild to moderate Alzheimer’s dementia after treatment with the acetylcholine precursor choline alfoscerate: a multicenter, double-blind, randomized, placebo-controlled trial // Clin Ther. 2003; 25: 1: 178-193.
14. Di Perri R, Coppola G, Ambrosio L. et al. A multicenter trial to evaluate the efficacy and tolerability of alpha-glycerylphosphorylcholine versus cytosine diphosphocholine in patients with vascular dementia // J Int Med Res.1991; 19: 4: 330-341.
15. Francis P.T., Palmer A.M., Snape M., Wilcock G.K. The cholinergic hypothesis of Alzheimer’s disease: a review of progress // J. Neurol. Neurosurg. Psychiatry. 1999; 66: 137-147.
16. Mandat T., Wilk A., Manowiec R. et al. Preliminary evaluation of risk and effectiveness of early choline alphoscerate treatment in craniocerebral injury // Neurol Neurochir Pol. 2003; 37: 6: 1231-1238.
17. Paciaroni E., Tomassini P. Controlled clinical trial of the efficacy and safety of choline alphoscerate (alpha-GPC) versus oxiracetam in patients with mild cognitive deficit of vascular origin // Giornal Italiano di Ricerche Cliniche e Terepeutiche.