Cervicitis hpv. HPV Detection in Cervical Conditions: Chronic Cervicitis to Carcinoma

27.02.197924.11.2021 by alexxlab

How is HPV detected in various cervical conditions. What are the prevalence rates of HPV in chronic cervicitis, cervical adenocarcinoma, intraepithelial neoplasia, and squamous cell carcinoma. How does HPV contribute to cervical cancer development.

Содержание

Understanding Human Papillomavirus (HPV) and Its Role in Cervical Conditions

Human papillomavirus (HPV) is a significant factor in cervical health and cancer development. As a member of the Papillomaviridae family, HPV is a small, non-enveloped virus that can infect epithelial cells of the cervix. Its presence has been linked to various cervical conditions, ranging from chronic cervicitis to more severe forms of cancer.

HPV infection is remarkably common, with cervical cancer being the second most prevalent malignancy in women globally. The virus’s ability to integrate into the host cell’s DNA and disrupt normal cellular functions makes it a key player in cervical carcinogenesis.

The Global Impact of HPV-Related Cervical Cancer

The global burden of HPV-related cervical cancer is substantial:

Approximately 493,000 new cases of cervical cancer are reported annually
An estimated 273,000 deaths occur each year due to cervical cancer
Over 80% of HPV-associated diseases are reported from low-income countries

These statistics underscore the importance of understanding HPV’s role in cervical conditions and developing effective screening and prevention strategies.

HPV Detection Methods in Cervical Samples

Detecting HPV in cervical samples is crucial for early intervention and management of cervical conditions. The study employed a nested PCR technique using consensus primers targeting the L1 protein-coding region of the HPV genome. This method allows for sensitive and specific detection of HPV DNA in various sample types.

The Nested PCR Approach

The nested PCR technique involves two rounds of amplification:

Initial amplification with MY09/MY11 primers
Second round of amplification with GP5+/GP6+ primers

This approach enhances sensitivity and specificity, allowing for detection of a broad range of HPV types in clinical samples.

HPV Prevalence in Chronic Cervicitis

Chronic cervicitis, an inflammation of the cervix, can have various causes, including HPV infection. The study revealed a surprisingly high prevalence of HPV in chronic cervicitis cases.

Is HPV common in chronic cervicitis cases. The study found that 78 out of 79 (98.7%) chronic cervicitis cases were positive for HPV. This rate is significantly higher than previously reported, suggesting a strong association between HPV and chronic cervical inflammation in the studied population.

Implications of High HPV Prevalence in Cervicitis

The high prevalence of HPV in chronic cervicitis cases has several implications:

Increased risk of progression to more severe cervical conditions
Need for more vigilant monitoring and follow-up of cervicitis cases
Potential for HPV testing as a screening tool in cervicitis management

HPV in Cervical Intraepithelial Neoplasia (CIN)

Cervical intraepithelial neoplasia (CIN) represents precancerous changes in cervical cells. The study examined CIN cases at various stages (I, II, III) for the presence of HPV.

How prevalent is HPV in CIN cases. The study detected HPV in 8 out of 20 (40%) CIN cases across all stages. This prevalence, while significant, is lower than rates reported in some other populations.

CIN Progression and HPV Persistence

The relationship between CIN progression and HPV persistence is complex:

Persistent HPV infection increases the risk of CIN progression
Higher-grade CIN lesions are more likely to harbor high-risk HPV types
Clearance of HPV infection may lead to regression of CIN lesions

HPV Detection in Cervical Adenocarcinoma

Cervical adenocarcinoma, a type of cervical cancer that develops from glandular cells, was also examined for HPV presence in this study.

What is the rate of HPV positivity in cervical adenocarcinoma cases. The study found that 5 out of 21 (23.8%) adenocarcinoma cases were positive for HPV. This rate is lower than typically reported for squamous cell carcinomas of the cervix.

HPV Types in Adenocarcinoma

While the study didn’t specify HPV types, it’s important to note that certain HPV types are more commonly associated with adenocarcinoma:

HPV 18 is frequently found in adenocarcinomas
HPV 16, while common in squamous cell carcinomas, can also be present in adenocarcinomas
Other high-risk types like HPV 45 may also be involved

HPV in Squamous Cell Carcinoma (SCC) of the Cervix

Squamous cell carcinoma is the most common type of cervical cancer, and its association with HPV is well-established. The study included SCC cases in its analysis.

How often is HPV detected in cervical squamous cell carcinoma. While the exact number wasn’t provided, the overall HPV positivity rate of 74.5% across all samples suggests a high prevalence in SCC cases, consistent with global data indicating nearly 100% HPV positivity in cervical SCCs.

HPV Types and SCC Development

The relationship between HPV types and SCC development is critical:

HPV 16 is the most common type found in cervical SCCs globally
Other high-risk types like HPV 18, 31, and 45 are also frequently detected
Persistent infection with high-risk HPV types significantly increases SCC risk

Geographical Variations in HPV Prevalence and Cervical Cancer Rates

The study’s findings highlight the importance of regional data in understanding HPV’s impact on cervical health. Geographical variations in HPV prevalence and cervical cancer rates can be significant.

Why do HPV prevalence and cervical cancer rates vary geographically. Several factors contribute to these variations:

Differences in sexual behaviors and practices
Varying levels of access to cervical cancer screening programs
Socioeconomic factors influencing healthcare access and education
Genetic factors that may affect susceptibility to HPV infection or cancer development

The Isfahan Province Study: A Unique Perspective

The study conducted in Isfahan Province, Iran, provides valuable insights into HPV prevalence in this region:

Lower rates of cervical carcinomas compared to global averages
Higher than expected HPV prevalence in chronic cervicitis cases
Potential influence of social and cultural factors on HPV transmission and cervical cancer development

The Role of HPV in Cervical Carcinogenesis

Understanding how HPV contributes to cervical cancer development is crucial for developing effective prevention and treatment strategies.

How does HPV cause cervical cancer. HPV’s carcinogenic potential is primarily due to its ability to integrate into the host cell’s genome and disrupt normal cellular functions:

Viral oncoproteins E6 and E7 interfere with tumor suppressor proteins p53 and pRb
This interference leads to uncontrolled cell proliferation and genomic instability
Accumulation of genetic mutations over time can result in malignant transformation
Persistent infection with high-risk HPV types is necessary for cancer development

From HPV Infection to Cancer: A Multistep Process

The progression from HPV infection to cervical cancer is not inevitable and involves several stages:

Initial HPV infection of cervical epithelial cells
Viral persistence and integration into the host genome
Development of precancerous lesions (CIN)
Progression to invasive cervical cancer

Most HPV infections are cleared by the immune system, but a small percentage persist and may lead to cancer development over time.

Implications for Cervical Cancer Screening and Prevention

The study’s findings have important implications for cervical cancer screening and prevention strategies, particularly in regions with limited resources.

How can HPV detection improve cervical cancer prevention. Incorporating HPV testing into screening programs can enhance early detection and prevention efforts:

HPV testing can identify women at higher risk of developing cervical cancer
Triage of HPV-positive women for further diagnostic procedures
Potential for extended screening intervals in HPV-negative women
Improved targeting of resources in low-resource settings

The Role of HPV Vaccination

HPV vaccination is a crucial component of cervical cancer prevention:

Vaccines targeting high-risk HPV types can prevent the majority of cervical cancers
Implementation of population-wide vaccination programs, especially for young girls
Potential for reducing HPV transmission and cervical cancer incidence over time

Future Directions in HPV Research and Cervical Cancer Management

The study’s findings open up several avenues for future research and improvements in cervical cancer management.

What are the key areas for future HPV and cervical cancer research. Important directions include:

Development of more sensitive and specific HPV detection methods
Investigation of HPV type distribution in different geographical regions
Exploration of host factors influencing HPV persistence and cancer development
Improvement of therapeutic strategies for HPV-related cervical conditions
Development of next-generation HPV vaccines with broader type coverage

Personalized Approaches to Cervical Cancer Prevention

Advancing towards personalized medicine in cervical cancer prevention involves:

Risk stratification based on HPV type and other biomarkers
Tailored screening and follow-up protocols for individual risk profiles
Integration of molecular testing with traditional cytology-based screening

These approaches aim to optimize resource allocation and improve outcomes in cervical cancer prevention and management.

Challenges in HPV Detection and Cervical Cancer Prevention in Low-Resource Settings

While the study provides valuable insights, it also highlights challenges in implementing comprehensive HPV detection and cervical cancer prevention programs, particularly in low-resource settings.

What are the main obstacles to effective HPV detection and cervical cancer prevention in developing countries. Key challenges include:

Limited access to healthcare facilities and screening programs
Lack of resources for implementing advanced HPV testing methods
Cultural and social barriers to cervical screening and HPV vaccination
Inadequate infrastructure for sample collection, storage, and analysis
Shortage of trained healthcare professionals to interpret results and manage patients

Innovative Solutions for Low-Resource Settings

Addressing these challenges requires innovative approaches:

Development of low-cost, point-of-care HPV testing methods
Implementation of screen-and-treat approaches to minimize loss to follow-up
Community-based education programs to increase awareness and acceptance of screening
Leveraging mobile health technologies for result communication and patient tracking
Training of community health workers to expand screening coverage

The Impact of Social and Cultural Factors on HPV Transmission and Cervical Cancer Risk

The study’s findings from Isfahan Province highlight the potential influence of social and cultural factors on HPV transmission and cervical cancer development.

How do social and cultural factors affect HPV prevalence and cervical cancer risk. Several aspects come into play:

Sexual behavior patterns, including number of lifetime partners
Age at first sexual intercourse
Use of barrier contraception methods
Smoking habits, which can increase cervical cancer risk
Cultural attitudes towards cervical screening and HPV vaccination

Tailoring Prevention Strategies to Cultural Contexts

Effective prevention strategies must be culturally sensitive and context-specific:

Engagement with community leaders and religious authorities
Development of culturally appropriate education materials
Addressing misconceptions about HPV and cervical cancer
Promoting family-centered approaches to encourage screening and vaccination

By considering these factors, prevention programs can be more effectively implemented and accepted within diverse communities.

The Potential of HPV Testing in Management of Chronic Cervicitis

The high prevalence of HPV in chronic cervicitis cases observed in the study suggests a potential role for HPV testing in managing this condition.

Can HPV testing improve the management of chronic cervicitis. Integrating HPV testing into cervicitis management could offer several benefits:

Identification of high-risk patients who may require closer monitoring
Guidance for treatment decisions and follow-up protocols
Early detection of cases at risk of progressing to more severe cervical lesions
Potential for reducing unnecessary treatments in HPV-negative cases

Implementing HPV Testing in Cervicitis Management

Practical considerations for incorporating HPV testing in cervicitis management include:

Development of standardized protocols for HPV testing in cervicitis cases
Training healthcare providers in interpreting and acting on HPV test results
Establishing clear guidelines for management based on HPV status
Ensuring cost-effectiveness of HPV testing in this context

By carefully implementing HPV testing in cervicitis management, healthcare providers may be able to improve patient outcomes and optimize resource allocation.

Detection of Human Papillomavirus in Chronic Cervicitis, Cervical Adenocarcinoma, Intraepithelial Neoplasia and Squamus Cell Carcinoma

Jundishapur J Microbiol. 2014 May; 7(5): e9930.

Elahe Mirzaie-Kashani

¹Department of Biology, Faculty of Science, University of Isfahan, Isfahan, IR Iran

Majid Bouzari

¹Department of Biology, Faculty of Science, University of Isfahan, Isfahan, IR Iran

Ardeshir Talebi

²Pathology Laboratory, Faculty of Medicine, Al-Zahra University Hospital, Isfahan University of Medical Sciences, Isfahan, IR Iran

Farahnaz Arbabzadeh-Zavareh

³Department of Operative Dentistry, Faculty of Dentistry, Isfahan University of Medical Sciences, Isfahan, IR Iran

¹Department of Biology, Faculty of Science, University of Isfahan, Isfahan, IR Iran

²Pathology Laboratory, Faculty of Medicine, Al-Zahra University Hospital, Isfahan University of Medical Sciences, Isfahan, IR Iran

³Department of Operative Dentistry, Faculty of Dentistry, Isfahan University of Medical Sciences, Isfahan, IR Iran

^*Corresponding author: Majid Bouzari, Department of Biology, Faculty of Science, University of Isfahan, Isfahan, IR Iran. Tel.: +98-3117932459, Fax: +98-3117932456, E-mail: ri.ca.iu.ics@irazuob, moc.oohay@irazuobm

Received 2012 Dec 26; Revised 2013 May 5; Accepted 2013 May 6.

This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

This article has been cited by other articles in PMC.

Abstract

Background:

Cervical cancer is the second most common cancer in women worldwide. Recent studies show that human papillomavirus (HPV) DNA is present in all cervical carcinomas and in some cervicitis cases, with some geographical variation in viral subtypes. Therefore determination of the presence of HPV in the general population of each region can help reveal the role of these viruses in tumors.

Objectives:

This study aimed to estimate the frequency of infection with HPV in cervicitis, cervical adenocarcinoma, intraepithelial neoplasia and squamus cell carcinoma samples from the Isfahan Province, Iran.

Patients and Methods:

One hundred and twenty two formalin fixed paraffin embedded tissue samples of crevicitis cases and different cervix tumors including cervical intraepithelial neoplasia (CIN) (I, II, III), squamus cell carcinoma (SCC) and adenocarcinoma were collected from histopathological files of Al-Zahra Hospital in Isfahan. Data about histopathological changes were collected by reexamination of the hematoxylin and eosin stained sections. DNA was extracted and subjected to Nested PCR using consensus primers, MY09/MY11 and GP5+/GP6+, designed for amplification of a conserved region of the genome coding for L1 protein.

Results:

In total 74.5% of the tested samples were positive for HPV. Amongst the tested tumors 8 out of 20 (40%) of CIN (I, II, III), 5 out of 21 (23.8%) of adenocarcinoma cases and 78 out of 79 chronic cervicitis cases were positive for HPV.

Conclusions:

The rate of different carcinomas and also the rate of HPV infection in each case were lower than other reports from different countries. This could be correlated with the social behavior of women in the area, where they mostly have only one partner throughout their life, and also the rate of smoking behavior of women in the studied population. On the other hand the rate of HPV infection in chronic cervicitis cases was much higher than cases reported by previous studies. This necessitates more attention to the role of human papillomaviruses in the their induction in the studied area.

Keywords: Polymerase Chain Reaction, Uterine Cervical Neoplasms, Uterine Cervicitis

1. Background

Human papillomaviruses (HPV) are members of the Papillomaviridae family, which are relatively small and non-enveloped (1, 2). After breast cancer cervical cancer represents the second most common malignancy in women worldwide (1, 3-5). Approximately 493000 new cases of cervical cancer and 27300 deaths are reported each year, of these over 80% of HPV-associated diseases are reported from low income countries, where national cervical cancer screening is not performed (4).

Cervicitis is most often caused by sexually transmitted pathogens of which the main agents are Chlamydia trachomatis and Neisseria gonorrhoeae. It may also be caused by systemic diseases such as autoimmune diseases, Stevens-Johnson syndrome, neoplasia, mechanical/chemical trauma and viral infection. Herpes simplex virus (HSV) and Trichomonas vaginalis may cause ectocervicitis. HPV infection may also cause visible papillary warts, leukoplakia or condyloma (6). In 1981, Zur Hausen et al. reported the detection of HPV DNA in cervical neoplasia (7, 8).

2. Objectives

As cervical cancer still remains as one of the major focuses of researchers, this study aimed to estimate the frequency of infection with HPV in cervix tumor samples and also chronic cervicitis cases from Isfahan’s population.

3. Patients and Methods

3.1. Tissue Samples

One hundred and twenty two formalin fixed paraffin embedded tissue samples of cervicitis and cervical cancers were collected from histopathological files of Al-Zahra hospital in Isfahan. Data about histopathological changes were collected by reexamination of the hematoxylin and eosin stained sections.

3.2. Deparaffinization of Tissue Sections

For deparaffinization, ten slices (four micrometers thick) were collected from each block and were subjected to Xylen treatment (1 mL) at 59˚C for 15 minutes in 1.5 mL Eppendorf tubes and centrifuged at 11300 × g for 10 minutes. The procedure was repeated three times, followed by three rounds of washes with 100% ethanol and centrifugation at 9660 × g for ten minutes. Finally, the samples were aired for 30 minutes.

3.3. DNA Extraction

The depariffinized tissue sections were treated with 900 µL of a solution containing 50 µL of 5 M NaCl, 200 µL of 0.5 M EDTA and 650 µL of retrieval solution (1 M Tris, 0.5 M EDTA, 10% sodium dodecyl sulfate (SDS)) and thermomixed at 59˚C and 450 rpm for 15 minutes. Next, 90 µL of 0.5 mg/mL proteinase K was added and thermomixed at 59˚C and 500 rpm for three hours. Equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) (Merck, Germany) was added and after five minutes, the solution was centrifuged at 4290 × g for 10 minutes. The upper phase was collected and transferred to another microtube and 0.1 volume of 3 M sodium acetate was added and vortexed for 1 minute then 2 volume of cold 100% ethanol (Merck, Germany) was added and incubated at -20˚C overnight. The precipitated DNA was centrifuged at 4˚C and 9660 × g. The supernatant was discarded and the DNA precipitate was washed once with 75% ethanol. The pelleted DNA was dissolved in 50 µL of distilled water or TE solution (Tris-HCL buffer (10 mM, pH = 8.0) containing 1 mM EDTA) after complete drying.

3.4. PCR Amplification

The MY09/MY11 and GP5+/GP6+ primer sets were used in the Nested-PCR (). The first outer MY primer set amplifies approximately 450 bp within the HPV L1 structural gene (2, 9, 10) while the internal Gp primers generate an approximately 150 bp long fragment from the HPV L1 region within the sequence amplified by the outer primer pair (My09/My11) (2, 11-13). DNA was amplified by two rounds of PCR. In the first round with 3.5 µL of DNA and in the second round with 1 µL of the PCR product in a 25 µL reaction mixture containing 1 U Smar Taq DNA Polymerase (Cinnagen, Iran), 0. 4 µM of each primers, 240 µM of each dNTPs, 20 mM of Tris-HCL, 3 mM MgCl₂, 50 mM KCl and 20 mM ammonium sulfate.

Table 1.

Sequence of Primers Used for the Nested PCR

Primers Name	Sequence of Primer
(Forward) My09	CGTCCMARRGGAWACTGATC
(Reverse) My11	GCMCAGGGWCATAAYAATGG
(Forward) Gp5+	TTTGTTACTGTGGTAGATACTAC
(Reverse) Gp6+	GAAAAATAAACTGTAAATCATATTC

Thermal cycling conditions in the first round were as follows: denaturation at 95˚C for five minutes followed by 44 cycles of denaturation at 95˚C for 30 seconds, annealing at 62˚C for 45 seconds and extension at 72˚C for 45 seconds. The amplification program was followed by a final extension step at 72˚C for seven minutes. Thermal cycling conditions in the second round were as follows: denaturation of 95˚C for five minutes followed by 44 cycles of denaturation at 95˚C for 30 seconds, annealing at 60˚C for 25 sec and extension at 72˚C for 45 seconds.

The amplification program was followed by a final extension step at 72˚C for seven minutes. PCR products (10 µL) of the second round were loaded on a 2% agarose gel (Sigma, Germany) containing ethidium bromide and electrophoresed and then DNA was visualized under UV light. Purity of the extracted DNA was estimated as the ratio between spectrophotometric absorbtion at 260 and 280 nm (OD260/OD280) (14). To verify the presence of carcinoma cells in the samples used for the PCR, different prepared paraffin-embedded biopsies were tested for histological evidence of tumors and along the blocks with carcinomas, blocks with normal tissues were also tested.

3.5. DNA sequencing and Computer Analysis of HPV Sequences

The detected bands of about 150 bp were extracted from the agarose gel using the Fermentas DNA extraction Kit Ko513 (Fermentas, Germany) according to manufacturer’s instructions. The extracted DNA was sequenced by the Applied Biosystem 3730 DNA Analyzer (Gene service, UK). A WU-BLAST-2 search of the determined sequences against a nucleotide sequence database (EMBL, European Bioinformatics Institute) was performed.

3.6. Statistical Analyses

Fisher’s Exact test was used for statistical analyses using GraphPad Instat software version 3.05 (GraphPad, USA).

4. Results

4.1. Histopathological Findings

Typical histopathological changes were observed in different tumors and cervicitis cases tested ( and ).

Adenocarcinoma: Malignant Changes Including the Hyperchromatism and Atypism of the Nucleus Are Observed in Cervical Glands

Chronic Cervicitis: Infiltration of Inflammatory Cells (lymphocytes) in Connective Tissue and Metaplasia of Endocervical Epithelium to Squamus Epithelium With no Malignancy Are Observed

4.2. PCR

In the PCR reaction 139 and 157 bp products were observed by gel electrophoresis of positive samples tested ().

Agarose Gel Showing PCR Products of Targeted DNAs Extracted From Four Tumor Samples and Four Cervicitis Samples

M, Marker; C-, Negative control; C+, Positive control; I, II, III, IV, Cervical cancers; V, VI, VII, VIII, Cervicitis.

4.3. Alignment

The PCR sequences obtained included three 139 bp and one 157 bp length sequences with accession numbers ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179958″,”term_id”:”241913749″,”term_text”:”GQ179958″}}GQ179958, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179959″,”term_id”:”241913751″,”term_text”:”GQ179959″}}GQ179959, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452050″,”term_id”:”259089716″,”term_text”:”GQ452050″}}GQ452050, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452049″,”term_id”:”259089715″,”term_text”:”GQ452049″}}GQ452049) (). Alignment of 139 bp sequences showed high levels of homology with other isolates of HPV (96-97%). For example, the homologies with isolates VI: {“type”:”entrez-nucleotide”,”attrs”:{“text”:”EU911303″,”term_id”:”217883798″,”term_text”:”EU911303″}}EU911303 and VI: {“type”:”entrez-nucleotide”,”attrs”:{“text”:”S73503″,”term_id”:”688183″,”term_text”:”S73503″}}S73503 were 97% and 96%, respectively. Alignment of the 157 bp sequence showed a high level of homology with other isolates of HPV (91-93%). For example, the homologies with isolates VI: {“type”:”entrez-nucleotide”,”attrs”:{“text”:”DQ312263″,”term_id”:”83658905″,”term_text”:”DQ312263″}}DQ312263 and VI: {“type”:”entrez-nucleotide”,”attrs”:{“text”:”S73503″,”term_id”:”688183″,”term_text”:”S73503″}}S73503 were 91% and 93%, respectively. Sequence alignment of 157 and 139 bp PCR products against prototype HPV (Human papillomavirus isolate 06JAN, accession number {“type”:”entrez-nucleotide”,”attrs”:{“text”:”EU911303″,”term_id”:”217883798″,”term_text”:”EU911303″}}EU911303) is shown in . As shown by the differences among the sequenced PCR products range from 1 to 5%. HPV DNA was detected in 13 out of 43 (32.5%) neoplastic cervical tissue samples and in 78 out of 79 (98.7%) chronic cervicitis cases. The frequency of HPV was significantly higher in chronic cervicitis cases (P < 0.001).

Table 2.

Sequences of PCR Products (Accession Numbers {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179958″,”term_id”:”241913749″,”term_text”:”GQ179958″}}GQ179958, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179959″,”term_id”:”241913751″,”term_text”:”GQ179959″}}GQ179959, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452049″,”term_id”:”259089715″,”term_text”:”GQ452049″}}GQ452049, GQ45205)

Accession No.	Sequence
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452049″,”term_id”:”259089715″,”term_text”:”GQ452049″}}GQ452049
	1 TTTGTTACTG TGGTAGATAC TACACGCAGT ACCAACATAA CATTATGTGC ATCCGTAACT
	61 ACTTATGTGC ATCAGTAACA ACATCTTCAT TACACCAATT CTGATTATAA AGAGTACATG
	121 CGTCATGTGG AAGAATATGA TTTAAAGTTT ATTTTTC
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452050″,”term_id”:”259089716″,”term_text”:”GQ452050″}}GQ452050
	1 TTTGTTACTG TGGTAGATAC TACACGCAGT ACCAACATGA CATTATGTGC ATCCGTAACT
	61 ACATCTTCCA CATACACCAA ATTCTGATTA TAAAGAGTAC ATGCGTCATG TGGAAGAATA
	121 TGATTTAAAG TTTATTTTTC
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179958″,”term_id”:”241913749″,”term_text”:”GQ179958″}}GQ179958
	1 GAAAAATAAA CTTTAAATCA TATTCTTCCT CATGACGCAT GTACTCTTTA TAATCAGAAT
	61 TGGTGTATGT GGAAGATGTA GTTACGGATG CACATAATGT CATGTTGGTA CTGCGTGTAG
	121 TATCTACCAC AGTAACAAA
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179959″,”term_id”:”241913751″,”term_text”:”GQ179959″}}GQ179959
	1 GAAAAATAAA CTTTAAATCA TATTCTTCCA TATGACGCAT GTACTCTTTA TAATCAGAAT
	61 TGGTGTATGT GGAAGATGTA GTTACGGATG CACATAATGT CATGTTGGTA CTGCGTGTAG
	121 TATCTACCAC AGTAACAAA

Sequence Alignment of the Four Detected Sequences (Accession Numbers {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179958″,”term_id”:”241913749″,”term_text”:”GQ179958″}}GQ179958, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179959″,”term_id”:”241913751″,”term_text”:”GQ179959″}}GQ179959, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452049″,”term_id”:”259089715″,”term_text”:”GQ452049″}}GQ452049, {“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452050″,”term_id”:”259089716″,”term_text”:”GQ452050″}}GQ452050) Against Prototype HPV (Accession Number {“type”:”entrez-nucleotide”,”attrs”:{“text”:”EU911303″,”term_id”:”217883798″,”term_text”:”EU911303″}}EU911303) (EMBL, European Bioinformatics Institute, WU-BLAST-2)

Table 3.

Sequence Difference Among PCR products Detected

	1	2	3	4
Sequence 1 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179958″,”term_id”:”241913749″,”term_text”:”GQ179958″}}GQ179958)	–	–	–	–
Sequence 2 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179959″,”term_id”:”241913751″,”term_text”:”GQ179959″}}GQ179959)	2%	–	–	–
Sequence 3 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452049″,”term_id”:”259089715″,”term_text”:”GQ452049″}}GQ452049)	1%	1%	–	–
Sequence 4 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452050″,”term_id”:”259089716″,”term_text”:”GQ452050″}}GQ452050)	5%	5%	4%	–

5.

Discussion

Worldwide, the second most common cancer in women is cervical cancer (3, 15). HPVs have been identified in 92.91% of a large series of cervical cancers collected internationally using PCR assays, of which 55 negative samples were tested again using HPV consensus GP5+/6+, E7 type-specific and CPI/II primers, where 72.7% were found to be positive for HPV. Thus, totally 97.2% of the cases were positive for HPV (14). In Norway, HPV was detected in 61% and 89% of neoplastic specimens from 1931 to 1960 and 1992 to 2004, respectively (3).

Santos et al. (16) tested 198 cases with invasive carcinomas of cervix in Peru of which 173 (87.4%), 15 (7.6%) and 10 (5%) were diagnosed as squamous cell carcinoma, adenocarcinoma and adenosquamous cell carcinoma, respectively; HPV was detected in 94.9% of cases (95.3% in squamous cell carcinoma and 92% in adenocarcinoma/adenosquamous carcinomas). In this study only two cases were diagnosed as squamous cell carcinoma and no HPV was detected in these cases. This shows the low prevalence of this type of carcinoma in Isfahan, Iran. Due to the low number of cases, comparison with other data was not possible. Of 21 adenocarcinoma cases, five (23.8%) were positive for HPV.

Forty percent (8) of the CIN cases (20) were positive for HPV. The rate of different carcinomas and also rate of HPV infection in each case were lower than other reports from different countries. This could be correlated to social behavior of women in the studied area, where women mostly have only one partner throughout their life, and also the rate of smoking behavior of women in the population studied. On the other hand the rate of HPV infection in chronic cervicitis cases was 78 out of 79 (98.7%), which is much higher than that reported by previous studies (17). As the same procedures were followed for all the tested cases, it is most unlikely that the positives scored in the cervicitis cases are due to cross contamination so the etiology remains to be established.

To verify the presence of carcinoma cells in the samples used for PCR, different prepared paraffin-embedded biopsies were tested for histological evidence of tumors and along the blocks with carcinomas, blocks with normal tissues were also tested. In eight cases, the blocks with or without histopathological evidence for carcinoma were tested for the presence of HPV. HPV was detected in normal tissues while the carcinoma sections were negative. The failure to detect HPV DNA in these cervical carcinomas may have been due to integration of HPV DNA and disruption of PCR primer sequences or loss of HPV L1 ORF (18). On the other hand the hit and run mechanism which has already been explained for Bovine papillomavirus-4 may be involved in cervical cancers (19).

Acknowledgments

This study was supported by a grant provided by the Office of Vice Chancellor for Research and Technology of the University of Isfahan.

Footnotes

Implication for health policy/practice/research/medical education:Determination of the presence of HPV in the general population of each region can help reveal the role of these viruses in tumors.

Authors’ Contribution:Elahe Mirzaie-Kashani, contributed to the development of the protocol and did the laboratory work and acquisition and interpretation of the data. Majid Bouzari, developed the original idea and study design, analyses and interpretation of the data and supervised the study. Ardeshir Talebi, prepared and examined histopathological sections and interpreted the changes observed. Farahnaz Arbabzadeh-Zavareh, analysis and interpretation of data.

Financial Disclosure:There are no competing financial interests.

Funding/Support:This study was supported by a grant provided by the Office of Vice Chancellor for Research and Technology of the University of Isfahan.

References

2. Remmerbach TW, Brinckmann UG, Hemprich A, Chekol M, Kuhndel K, Liebert UG. PCR detection of human papillomavirus of the mucosa: comparison between MY09/11 and GP5+/6+ primer sets. J Clin Virol. 2004;30(4):302–8. doi: 10.1016/j. jcv.2003.12.011. [PubMed] [CrossRef] [Google Scholar]3. Bertelsen BI, Kugarajh K, Skar R, Laerum OD. HPV subtypes in cervical cancer biopsies between 1930 and 2004: detection using general primer pair PCR and sequencing. Virchows Arch. 2006;449(2):141–7. doi: 10.1007/s00428-006-0232-3. [PubMed] [CrossRef] [Google Scholar]4. Gheit T, Vaccarella S, Schmitt M, Pawlita M, Franceschi S, Sankaranarayanan R, et al. Prevalence of human papillomavirus types in cervical and oral cancers in central India. Vaccine. 2009;27(5):636–9. doi: 10.1016/j.vaccine.2008.11.041. [PubMed] [CrossRef] [Google Scholar]5. Nobbenhuis MA, Walboomers JM, Helmerhorst TJ, Rozendaal L, Remmink AJ, Risse EK, et al. Relation of human papillomavirus status to cervical lesions and consequences for cervical-cancer screening: a prospective study. Lancet. 1999;354(9172):20–5. doi: 10.1016/S0140-6736(98)12490-X. [PubMed] [CrossRef] [Google Scholar]6. Lusk MJ, Konecny P. Cervicitis: a review. Curr Opin Infect Dis. 2008;21(1):49–55. doi: 10.1097/QCO.0b013e3282f3d988. [PubMed] [CrossRef] [Google Scholar]7. Motoyama S, Ladines-Llave CA, Luis Villanueva S, Maruo T. The role of human papilloma virus in the molecular biology of cervical carcinogenesis. Kobe J Med Sci. 2004;50(1-2):9–19. [PubMed] [Google Scholar]8. Zur Hausen H, de Villiers EM, Gissmann L. Papillomavirus infections and human genital cancer. Gynecol Oncol. 1981;12(2):S124–8. doi: 10.1016/0090-8258(81)90067-6. [PubMed] [CrossRef] [Google Scholar]9. Gravitt PE, Peyton CL, Apple RJ, Wheeler CM. Genotyping of 27 human papillomavirus types by using L1 consensus PCR products by a single-hybridization, reverse line blot detection method. J Clin Microbiol. 1998;36(10):3020–7. [PMC free article] [PubMed] [Google Scholar]10. Manosm MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. Use of polymerase chain reaction amplification for the detection ogenital human papillomaviruses. Cancer Cells. 1989;7(1):209–14. [Google Scholar]11. de Roda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Snijders PJ. The use of general primers GP5 and GP6 elongated at their 3′ ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol. 1995;76 ( Pt 4):1057–62. [PubMed] [Google Scholar]12. Jacobs MV, de Roda Husman AM, van den Brule AJ, Snijders PJ, Meijer CJ, Walboomers JM. Group-specific differentiation between high- and low-risk human papillomavirus genotypes by general primer-mediated PCR and two cocktails of oligonucleotide probes. J Clin Microbiol. 1995;33(4):901–5. [PMC free article] [PubMed] [Google Scholar]13. Jacobs MV, Snijders PJ, van den Brule AJ, Helmerhorst TJ, Meijer CJ, Walboomers JM. A general primer GP5+/GP6(+)-mediated PCR-enzyme immunoassay method for rapid detection of 14 high-risk and 6 low-risk human papillomavirus genotypes in cervical scrapings. J Clin Microbiol. 1997;35(3):791–5. [PMC free article] [PubMed] [Google Scholar]14. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. New York: Cold spring harbor laboratory press; 1989. [Google Scholar]15. World Health Organization. Conquering suffering, enriching humanity: executive summary.. Geneva: WHO; 1997. [Google Scholar]16. Santos C, Munoz N, Klug S, Almonte M, Guerrero I, Alvarez M, et al. HPV types and cofactors causing cervical cancer in Peru. Br J Cancer. 2001;85(7):966–71. doi: 10.1038/sj.bjc.6691948. [PMC free article] [PubMed] [CrossRef] [Google Scholar]17. Prokopakis P, Sourvinos G, Koumantaki Y, Koumantakis E, Spandidos DA. K-ras mutations and HPV infection in cervicitis and intraepithelial neoplasias of the cervix. Oncol Rep. 2002;9(1):129–33. [PubMed] [Google Scholar]18. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999;189(1):12–9. doi: 10.1002/(SICI)1096-9896(199909)189:1<12::AID-PATh531>3.0.CO;2-F. [PubMed] [CrossRef] [Google Scholar]19. Howley PM, Lowey DR. Papillomaviuses. In: Knipe DM, Howley PM, editors. Field’s virology. . Philadelphia: Lippincott Williams & Wilkins; 2007. pp. 2300–50. [Google Scholar]

Detection of Human Papillomavirus in Chronic Cervicitis, Cervical Adenocarcinoma, Intraepithelial Neoplasia and Squamus Cell Carcinoma

Jundishapur J Microbiol. 2014 May; 7(5): e9930.

Elahe Mirzaie-Kashani

¹Department of Biology, Faculty of Science, University of Isfahan, Isfahan, IR Iran

Majid Bouzari

¹Department of Biology, Faculty of Science, University of Isfahan, Isfahan, IR Iran

Ardeshir Talebi

²Pathology Laboratory, Faculty of Medicine, Al-Zahra University Hospital, Isfahan University of Medical Sciences, Isfahan, IR Iran

Farahnaz Arbabzadeh-Zavareh

³Department of Operative Dentistry, Faculty of Dentistry, Isfahan University of Medical Sciences, Isfahan, IR Iran

¹Department of Biology, Faculty of Science, University of Isfahan, Isfahan, IR Iran

²Pathology Laboratory, Faculty of Medicine, Al-Zahra University Hospital, Isfahan University of Medical Sciences, Isfahan, IR Iran

³Department of Operative Dentistry, Faculty of Dentistry, Isfahan University of Medical Sciences, Isfahan, IR Iran

Received 2012 Dec 26; Revised 2013 May 5; Accepted 2013 May 6.

This article has been cited by other articles in PMC.

Abstract

Background:

Objectives:

This study aimed to estimate the frequency of infection with HPV in cervicitis, cervical adenocarcinoma, intraepithelial neoplasia and squamus cell carcinoma samples from the Isfahan Province, Iran.

Patients and Methods:

Results:

Conclusions:

Keywords: Polymerase Chain Reaction, Uterine Cervical Neoplasms, Uterine Cervicitis

1. Background

2. Objectives

3. Patients and Methods

3.1. Tissue Samples

3.2. Deparaffinization of Tissue Sections

3.3. DNA Extraction

3.4. PCR Amplification

Table 1.

Sequence of Primers Used for the Nested PCR

Primers Name	Sequence of Primer
(Forward) My09	CGTCCMARRGGAWACTGATC
(Reverse) My11	GCMCAGGGWCATAAYAATGG
(Forward) Gp5+	TTTGTTACTGTGGTAGATACTAC
(Reverse) Gp6+	GAAAAATAAACTGTAAATCATATTC

3.5. DNA sequencing and Computer Analysis of HPV Sequences

3.6. Statistical Analyses

Fisher’s Exact test was used for statistical analyses using GraphPad Instat software version 3.05 (GraphPad, USA).

4. Results

4.1. Histopathological Findings

Typical histopathological changes were observed in different tumors and cervicitis cases tested ( and ).

Adenocarcinoma: Malignant Changes Including the Hyperchromatism and Atypism of the Nucleus Are Observed in Cervical Glands

Chronic Cervicitis: Infiltration of Inflammatory Cells (lymphocytes) in Connective Tissue and Metaplasia of Endocervical Epithelium to Squamus Epithelium With no Malignancy Are Observed

4.2. PCR

In the PCR reaction 139 and 157 bp products were observed by gel electrophoresis of positive samples tested ().

Agarose Gel Showing PCR Products of Targeted DNAs Extracted From Four Tumor Samples and Four Cervicitis Samples

M, Marker; C-, Negative control; C+, Positive control; I, II, III, IV, Cervical cancers; V, VI, VII, VIII, Cervicitis.

4.3. Alignment

Table 2.

Accession No.	Sequence
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452049″,”term_id”:”259089715″,”term_text”:”GQ452049″}}GQ452049
	1 TTTGTTACTG TGGTAGATAC TACACGCAGT ACCAACATAA CATTATGTGC ATCCGTAACT
	61 ACTTATGTGC ATCAGTAACA ACATCTTCAT TACACCAATT CTGATTATAA AGAGTACATG
	121 CGTCATGTGG AAGAATATGA TTTAAAGTTT ATTTTTC
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452050″,”term_id”:”259089716″,”term_text”:”GQ452050″}}GQ452050
	1 TTTGTTACTG TGGTAGATAC TACACGCAGT ACCAACATGA CATTATGTGC ATCCGTAACT
	61 ACATCTTCCA CATACACCAA ATTCTGATTA TAAAGAGTAC ATGCGTCATG TGGAAGAATA
	121 TGATTTAAAG TTTATTTTTC
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179958″,”term_id”:”241913749″,”term_text”:”GQ179958″}}GQ179958
	1 GAAAAATAAA CTTTAAATCA TATTCTTCCT CATGACGCAT GTACTCTTTA TAATCAGAAT
	61 TGGTGTATGT GGAAGATGTA GTTACGGATG CACATAATGT CATGTTGGTA CTGCGTGTAG
	121 TATCTACCAC AGTAACAAA
{“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179959″,”term_id”:”241913751″,”term_text”:”GQ179959″}}GQ179959
	1 GAAAAATAAA CTTTAAATCA TATTCTTCCA TATGACGCAT GTACTCTTTA TAATCAGAAT
	61 TGGTGTATGT GGAAGATGTA GTTACGGATG CACATAATGT CATGTTGGTA CTGCGTGTAG
	121 TATCTACCAC AGTAACAAA

Table 3.

Sequence Difference Among PCR products Detected

	1	2	3	4
Sequence 1 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179958″,”term_id”:”241913749″,”term_text”:”GQ179958″}}GQ179958)	–	–	–	–
Sequence 2 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ179959″,”term_id”:”241913751″,”term_text”:”GQ179959″}}GQ179959)	2%	–	–	–
Sequence 3 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452049″,”term_id”:”259089715″,”term_text”:”GQ452049″}}GQ452049)	1%	1%	–	–
Sequence 4 ({“type”:”entrez-nucleotide”,”attrs”:{“text”:”GQ452050″,”term_id”:”259089716″,”term_text”:”GQ452050″}}GQ452050)	5%	5%	4%	–

5.

Discussion

Acknowledgments

This study was supported by a grant provided by the Office of Vice Chancellor for Research and Technology of the University of Isfahan.

Footnotes

Financial Disclosure:There are no competing financial interests.

Funding/Support:This study was supported by a grant provided by the Office of Vice Chancellor for Research and Technology of the University of Isfahan.

References

2. Remmerbach TW, Brinckmann UG, Hemprich A, Chekol M, Kuhndel K, Liebert UG. PCR detection of human papillomavirus of the mucosa: comparison between MY09/11 and GP5+/6+ primer sets. J Clin Virol. 2004;30(4):302–8. doi: 10.1016/j.jcv.2003.12.011. [PubMed] [CrossRef] [Google Scholar]3. Bertelsen BI, Kugarajh K, Skar R, Laerum OD. HPV subtypes in cervical cancer biopsies between 1930 and 2004: detection using general primer pair PCR and sequencing. Virchows Arch. 2006;449(2):141–7. doi: 10.1007/s00428-006-0232-3. [PubMed] [CrossRef] [Google Scholar]4. Gheit T, Vaccarella S, Schmitt M, Pawlita M, Franceschi S, Sankaranarayanan R, et al. Prevalence of human papillomavirus types in cervical and oral cancers in central India. Vaccine. 2009;27(5):636–9. doi: 10.1016/j.vaccine.2008.11.041. [PubMed] [CrossRef] [Google Scholar]5. Nobbenhuis MA, Walboomers JM, Helmerhorst TJ, Rozendaal L, Remmink AJ, Risse EK, et al. Relation of human papillomavirus status to cervical lesions and consequences for cervical-cancer screening: a prospective study. Lancet. 1999;354(9172):20–5. doi: 10.1016/S0140-6736(98)12490-X. [PubMed] [CrossRef] [Google Scholar]6. Lusk MJ, Konecny P. Cervicitis: a review. Curr Opin Infect Dis. 2008;21(1):49–55. doi: 10.1097/QCO.0b013e3282f3d988. [PubMed] [CrossRef] [Google Scholar]7. Motoyama S, Ladines-Llave CA, Luis Villanueva S, Maruo T. The role of human papilloma virus in the molecular biology of cervical carcinogenesis. Kobe J Med Sci. 2004;50(1-2):9–19. [PubMed] [Google Scholar]8. Zur Hausen H, de Villiers EM, Gissmann L. Papillomavirus infections and human genital cancer. Gynecol Oncol. 1981;12(2):S124–8. doi: 10.1016/0090-8258(81)90067-6. [PubMed] [CrossRef] [Google Scholar]9. Gravitt PE, Peyton CL, Apple RJ, Wheeler CM. Genotyping of 27 human papillomavirus types by using L1 consensus PCR products by a single-hybridization, reverse line blot detection method. J Clin Microbiol. 1998;36(10):3020–7. [PMC free article] [PubMed] [Google Scholar]10. Manosm MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. Use of polymerase chain reaction amplification for the detection ogenital human papillomaviruses. Cancer Cells. 1989;7(1):209–14. [Google Scholar]11. de Roda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Snijders PJ. The use of general primers GP5 and GP6 elongated at their 3′ ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol. 1995;76 ( Pt 4):1057–62. [PubMed] [Google Scholar]12. Jacobs MV, de Roda Husman AM, van den Brule AJ, Snijders PJ, Meijer CJ, Walboomers JM. Group-specific differentiation between high- and low-risk human papillomavirus genotypes by general primer-mediated PCR and two cocktails of oligonucleotide probes. J Clin Microbiol. 1995;33(4):901–5. [PMC free article] [PubMed] [Google Scholar]13. Jacobs MV, Snijders PJ, van den Brule AJ, Helmerhorst TJ, Meijer CJ, Walboomers JM. A general primer GP5+/GP6(+)-mediated PCR-enzyme immunoassay method for rapid detection of 14 high-risk and 6 low-risk human papillomavirus genotypes in cervical scrapings. J Clin Microbiol. 1997;35(3):791–5. [PMC free article] [PubMed] [Google Scholar]14. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. New York: Cold spring harbor laboratory press; 1989. [Google Scholar]15. World Health Organization. Conquering suffering, enriching humanity: executive summary.. Geneva: WHO; 1997. [Google Scholar]16. Santos C, Munoz N, Klug S, Almonte M, Guerrero I, Alvarez M, et al. HPV types and cofactors causing cervical cancer in Peru. Br J Cancer. 2001;85(7):966–71. doi: 10.1038/sj.bjc.6691948. [PMC free article] [PubMed] [CrossRef] [Google Scholar]17. Prokopakis P, Sourvinos G, Koumantaki Y, Koumantakis E, Spandidos DA. K-ras mutations and HPV infection in cervicitis and intraepithelial neoplasias of the cervix. Oncol Rep. 2002;9(1):129–33. [PubMed] [Google Scholar]18. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999;189(1):12–9. doi: 10.1002/(SICI)1096-9896(199909)189:1<12::AID-PATh531>3.0.CO;2-F. [PubMed] [CrossRef] [Google Scholar]19. Howley PM, Lowey DR. Papillomaviuses. In: Knipe DM, Howley PM, editors. Field’s virology.. Philadelphia: Lippincott Williams & Wilkins; 2007. pp. 2300–50. [Google Scholar]

Effect of Dialyzable Leukocyte Extract on chronic cervicitis in patients with HPV infection

J Med Life. 2017 Oct-Dec; 10(4): 237–243.

,^*,^**,^*,^***,^*,^****,^*****,^*,^******,^******* and ^*

MP Acosta-Rios

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

E Sauer-Ramírez

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

LJ Castro-Muñoz

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

M García-Solís

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

C Gómez-García

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

R Ocadiz-Delgado

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

A Martinez-Martinez

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

V Sánchez-Monroy

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

C Pérez-De la Mora

^******FARMAINMUNE, Azcapotzalco Mexico

B Correa-Meza

^*******BIOXPORT, Azcapotzalco Mexico

DG Perez-Ishiwara

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

^******FARMAINMUNE, Azcapotzalco Mexico

^*******BIOXPORT, Azcapotzalco Mexico

Correspondence to: David Guillermo Perez-Ishiwara, Ph.D. ENMyH,
Instituto Politécnico Nacional. 239 Guillermo Massieu Helguera Street, La Escalera, C.P. 07320 Mexico DF, Mexico,
Phone: +52 (01) 5729 6300 Ext. 55534, E-mail: [email protected]

Received 2017 Nov 24; Accepted 2017 Dec 19.

This article is distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/3.0/), which permits unrestricted use and redistribution provided that the original author and source are credited.This article has been cited by other articles in PMC.

Supplementary Materials

Fig. S1. Representative IFTR profiles of human and crocodile DLE.

GUID: D1E06B72-5901-42C7-9CEE-F719326B7739

Table S1. Patients’ demographics.

GUID: 3648694E-D60C-4CCB-B730-2B7A5AFCCE00

Abstract

The objective of the study was to assess the clinical, histopathological and immunochemical changes induced by dialyzable leukocyte extract (DLE) treatment in patients with chronic cervicitis associated to HPV infection. Fifty-four female Mexican patients diagnosed with chronic cervicitis, cervical intra-epithelial neoplasia grade 1 (CIN 1) and HPV infection were divided into two groups: patients treated with placebo and patients treated with DLE. Clinical and colposcopy evaluations were performed before and after treatments. Cervix biopsies were obtained to analyze histopathological features and to determine the local immunological changes by immunohistochemistry analyses. Placebo-treated patients showed no significant changes in the evaluated parameters. Interestingly, in DLE-treated patients, clinical manifestations of cervicitis diminished and 89% of them remitted the colposcopic lesions. Histological analyses of biopsies from DLE-treated patients showed a decreasing leukocyte infiltrate. Immunochemical analyses showed an increased expression of TGF-β, while expression of IFN-γ, PCNA, and IL-32 decreased. Our results suggest that DLE can stimulate innate immunity of cervical mucosae, diminishing chronic cervicitis in HPV-infected patients.

Trial registration: Register ISRCTN16429164

Abbreviations:
HPV = Human Papilloma Virus; DLE = Dialyzable leukocyte extract

Keywords: HPV, DLE, chronic cervicitis

Introduction

Chronic cervicitis in patients infected with persistent HPV genotypes has been associated with malignancy evolution and has been considered a very important factor triggering carcinogenesis; persistent inflammation increased cellular epithelium turnover, enhancing genetic alterations conjointly with the viral infection [1]. Patients with HPV infection usually present common symptoms of chronic cervicitis such as vaginal discharge and vaginal bleeding, dolor, vulvar or vaginal irritation and dysuria. Colposcopy findings include vaginal discharge, vaginal bleeding, cervical erythema, friability, erosion, and edema [2]. Histological analysis of the affected region, revealed besides cervicitis, several manifestations of HPV infection such as acanthosis, squamous metaplasia and koilocytic atypia [3]. Dialyzable leukocyte extract (DLE) has been reported as a modulator of the immune response, which up-regulated synthesis of molecules such as IL-2 and the activation and chemotaxis of macrophages and natural killer cells [4][5][6]. The DLE has been clinically tested in some diseases caused by viruses, fungi and parasites and has been used as adjuvant treatment for asthma, rheumatoid arthritis, atopic dermatitis, and respiratory infections [7][8][9][10][11][12][13][14][15]. Multiple evidence also suggest that the DLE administration increase CD4, CD8, CD16 and CD56 T-lymphocyte subpopulations in some pathologies [16][17]. In 2015, Rodriguez et al. specifically documented that DLE treatment in patients with low-grade cervical lesions, diminished or abolished HPV viral load, correlating it with clinical improvement [18]. Recently, we demonstrated that DLE promotes the expression of anti-inflammatory cytokines, avoiding NF-κB translocation to the nucleus in a rat osteoarthritis model and also that DLE modulates the inflammatory response in experimental autoimmune prostatitis [19][20].

Here, we evaluate the clinical effect of DLE treatment in CIN 1 patients with chronic cervicitis to down-regulate the inflammation process, registering the cervix tissue changes by colposcopy, histopathology, and immunochemical studies.

Material and Methods

A total of 54 female Mexican patients with a cytological diagnosis of CIN 1, chronic cervicitis and HPV infection, were included. The protocol with the registration number 0152013 was reviewed and approved by the Ethics Committee of the National School of Medicine and Homeopathy from National Polytechnic Institute (Mexico). All the women included in the study signed the informed consent to be included in the protocol; chronically ill women who had diabetes, allergies, autoimmunity diseases, AIDS or other sexually transmitted diseases were excluded, likewise pregnant and menopausal women.

Clinical signs and symptoms of the women included in the study were evaluated. For colposcopy, the localization and description of the lesion were performed according to the number of cervical quadrants of the lesion covered; likewise, the area of the lesion was described according to the cervical area percentage [3]. Then, biopsies were processed as described below for histopathological analysis, selecting for the study those with confirmed chronic cervicitis and CIN 1 diagnosis. HPV infection was corroborated by PCR using the DNA extracted from 10µm thick biopsy sections using the QIAamp DNA Mini Kit (QIAGEN, USA) and the multiplex PCR Kit for Human Papilloma Virus (Maxim Biotech, Inc, USA) according to manufacturer’s instructions.

Selected patients were randomly divided into two groups: placebo and DLE-treatment groups. DLE was prepared by repeated freezing and thawing of leukocytes isolated from Crocodylus moreletti. The dialyzed extract of leukocytes was adjusted by protein concentration and stored lyophilized until use. One unit of DLE containing 0.100 mg of extract and Glycine (150 mg) was reconstituted in 2 ml of bi-distilled sterile water. Otherwise, one unit of placebo only containing Glycine (150 mg) was also reconstituted in 2 ml of bi-distilled sterile water. Patients from both placebo and DLE-treated groups were orally administered the solution at every 72 hours for four weeks.

At the end of the treatment patients were clinically evaluated again and assessed by colposcopy, and cervical samples were taken for both histopathological and immunohistochemical analyses.

Hematoxylin and eosin (H&E) staining (Sigma Aldrich, St Louis, MO, USA) was performed to analyze the histopathological characteristics of the lesions. Briefly, tissue sections (3 μm thick) were cut using the microtome (American Optical rotary microtome 820). Then, histologic sections were immersed in xylene to remove excess paraffin. Tissue sections were rehydrated by passing through a decreasing concentration gradient of alcohol and water baths (100%, 90%, 80%, and 70%). Subsequently, the tissue sections were immersed in hematoxylin for 10 minutes and rinsed in tap water until the sections exhibited a blue coloration. The tissue sections were immersed in 1% alcoholic acid (1% HCl in 70% alcohol) for 5 minutes. Then, the histological sections were washed in running water, placed into the eosin for 30 seconds and treated with another series of alcohol baths, in increasing order (70%, 95%, and 100%). Finally, the sections were left in xylol for 10 minutes and mounted on electrocharged glass slides (Fischer Scientific, USA). Protein detection was performed using the Mouse/Rabbit PolyDetector HRP/DAB Detection System (Bio SB, USA) according to the manufacturer’s instructions. Briefly, the tissues were rinsed with 10% formaldehyde in phosphate-buffered saline (PBS), and epitope retrieval was performed in a pressure cooker (121°C, 20 lb. of pressure) using the ImmunoRetriever Citrate Solution (Bio SB, USA) for 15 min. The slides were cooled at room temperature (30 min), and the tissues were treated with PolyDetector Peroxidase Block quenching buffer (Bio SB, USA) for 1 minute. After three PBS washes, the sections were incubated at 4°C for 16 hr with monoclonal antibodies against PCNA, TGF-β and IFN γ proteins (Santa Cruz Biotechnology, USA) and a polyclonal primary antibody against IL-32, (Abcam, USA). Antibodies were used at a 1:50 dilution. After four PBS washes, the slides were incubated with the secondary antibody (PolyDetector HRP label; Bio SB, USA) for 30 min. After three PBS washes, the sections were incubated with the appropriate substrate (PolyDetector DAB chromogen; Bio SB, USA), counterstained with hematoxylin and mounted in GVA-mount reagent (Zymed, USA). Negative controls were performed without the primary antibody incubation.

For digital immunohistochemical analyses, all photomicrographs were obtained using a DFC290 HD digital camera (Leica Microsystems, USA), processed in the PhotoImpact software (Ulead PhotoImpact SE ver. 3.02; Ulead Systems, U.S.A.), and digitally analyzed using the Image-ProPlus Analysis Software (Version 4.5.0.19, Media Cybernetics, Inc., and U.S.A). The chromogen quantity was determined by calculating the norm of the matrix file for each image using the “Measure” tool. This allows pixels of similar “color” immediately adjacent to the index pixel to be included for analysis. All pixels falling within the selected threshold parameters were quantified, recorded, and used to generate the graphs. The file for the control image is generated similarly: The biopsy control slide is acquired and treated identically as the experimental slide except that negative controls were included. Likewise, digital analyses were performed counting 16 representative epithelial cervical areas from each sample biopsy. The % labeling index was obtained by the formula: labelling index = (100%) *(positive signal) / total signal.

Results

Fifty-four Mexican women with chronic cervicitis, CIN 1 and HPV infection with the ages ranging from 20 to 65 years old were included in the study. From the total, 19 did not present clinical symptoms, and 35 had gynecological symptoms such as white vaginal fluid, pelvic pain and recurrent urinary tract infections. The post-treatment symptoms of the patients receiving placebo essentially reported no changes, while 90% of the patients treated with DLE had resolved most of the symptoms ().

Table 1

Clinical evaluation of experimental groups

Symptoms	Number of Patients
	DLE treatment		Placebo treatment
	Before	After	Before	After
White vaginal fluid	11	1	8	8
Bleeding	0	0	0	0
Pelvic Pain	4	1	2	2
Recurrent urinary tract infection	7	0	3	3

Colposcopic analyses before and after treatments were performed documenting the anatomical localization and size of the lesions. Before treatment, a thin acetowhite epithelium with irregular borders, fine punctuation, and a fine mosaic pattern was observed (). After the therapeutic intervention, the lesions observed in patients from the placebo group did not display differences. In contrast, in the DLE-treated patients, we observed normal colposcopy images in 89% of cases, showing a cervix with a uniform pink color without visible injuries (). After one year of colposcopy monitoring, patients did not show recurrence or persistence of the lesions.

Comparative colposcopy images of the cervix from representative patients before and after placebo or DLE treatments. The images are representative of patients from each group. The arrows indicate the resolution of acetowhite lesion after the treatment with DLE

Before therapeutic intervention with DLE, H&E staining analysis of the cervical tissues from both groups showed histological alterations including hyperchromatic and pleomorphic cells with abnormal chromatin distribution; vascular congestion; and important inflammatory process with edema and leukocyte infiltration in the stroma (A). The dysplastic cells occupied the lower third of the epithelium, classifying it as a low-grade lesion (CIN 1). No changes were observed in the biopsies obtained from the placebo group after treatments. However, the DLE treated group showed important differences, the histological architecture of the cervical epithelium was more conserved, with discrete reduction of dysplastic cells; the basal membrane was continuous and well defined; there was a reduction of stromal edema and vascular congestion by approximately 40%; the parabasal, middle and superficial areas were observed with a better cell differentiation (A). Likewise, in the stroma, we observed a statistically significant reduction of leukocyte infiltration of about 50% on average (B).

Representative images of histopathological features of cervix tissues. (A) H-E staining of cervix samples from patients before and after treatment with placebo or DLE. The decrease of the inflammatory process in patients treated with DLE was observed. (B) Semiquantitative analyses of infiltrating leukocytes into the stroma. The asterisk marks statistically significant differences (p<0.05). The analyses were performed counting 16 representative epithelial cervical areas from each sample biopsy.

Treatment

Considering the histopathological changes induced by DLE, we measured the cell proliferation levels in cervical epithelia. Immunohistochemical analyses for Nuclear Proliferating Cell Antigen (PCNA) protein showed positive staining in the basal and parabasal layers of cervical tissues of patients from both groups before treatment and tissues from the placebo-treated group (A). In contrast, samples obtained from DLE-treated patients showed a decreased PCNA staining, detecting it mainly in the basal layer. The immunostaining decrease observed was approximately 19% on average, and it was statistically significant, (p<0.05) (B).

Immunohistochemical detection of PCNA. (A) Representative images of cervix biopsies from a patient before and after treatments. The arrows indicate the nuclear PCNA immunolabeling. The decrease of immunolabeling of PCNA in patients treated with DLE was observed (B) Semiquantitative analysis of PCNA detection. The asterisk marks statistically significant differences (p<0.05). The analyses were performed counting 16 representative epithelial cervical areas from each sample biopsy

We searched for the detection of TGF-β, IFNγ and IL-32 cytokines implicated in both the HPV infection and cervicitis process. Results showed that cervical tissues from the placebo group did not display significant differences in the detection patterns of TGFβ, IFNγ and IL-32, before and after treatment. Conversely, cervixes from DLE-treated patients showed some differences. Before treatment, the immunostaining for TGF-β was limited to the middle and parabasal layers of the cervical epithelium, while after DLE treatment the immunostaining was evident in almost all epithelium, increasing with 38% on average (p<0.05) (A,B).

(A) Immunohistochemical detection of TGF-β, IFN γ and IL-32. Representative images of cervix biopsies from a patient before and after treatments. The increase of immunolabeling of TGF-β and the decrease of INF-γ and IL-32 in patients treated with DLE were observed (B) Semiquantitative analyzes of immunohistochemical staining for TGF-β, IFN γ and IL-32. The asterisk marks statistically significant differences (p<0.05). The analyses were performed counting 16 representative epithelial cervical areas from each sample biopsy

IFN-γ detection was observed before DLE treatment throughout the epithelium, being more intense in the middle epithelial layer. Interestingly, after treatment, we found that staining significantly decreased in all epithelial layers, decreasing the labeling index with 35% on average (A,B).

Finally, IL-32 was detected before treatment in the medial and superficial layers of cervical epithelia, while after DLE treatment we observed a significant decrease, detecting a faint signal mainly in the middle layer of cervical epithelium (A). Statistical analysis showed that the decrease was significant, diminishing with approximately 30% on average (p<0.05) (B).

Discussions

Chronic cervicitis in patients infected with persistent HPV genotypes is a very important factor triggering viral-induced carcinogenesis [21]. An effective mucosae immune response has been related to an effective priming of the adaptive immune response facilitating viral resolution. Thus different immune modulators have been studied to enhance or to promote the innate immune response [22][23]. Among them, the dialyzable leukocytes extract (DLE) has been used in viral infections, and it could be used as a putative co-adjuvant strategy to stimulate the mucosal immunity [4]-[20]. In the present work, we evaluated the effect of DLE treatment to diminish chronic cervicitis in CIN 1 HPV patients, focusing our evaluation on the modification of some important cervical mucosae immunity factors for anti-inflammatory and anti-viral responses.

The clinical symptoms of 54 patients with a diagnosis of chronic cervicitis and HPV infection lesions showed that 64% of them displayed symptoms associated with HPV infection and cervicitis; these data are in concordance with the meta-analysis described by Gillet in 2011 [24], reporting a positive association between bacterial vaginosis and uterine cervical HPV infection.

Interestingly, we found that after administration of one unit of DLE at every 72 hours for four weeks, in most of the patients, cervicitis symptoms diminished; colposcopically, lesions associated with cervicitis and HPV infection were solved in 89% of the cases. These results are in concordance with the study that Rodriguez et al. conducted in 2015, in which they found that patients with low-grade intraepithelial squamous cervical lesions treated with human DLE decreased the size or produced the absence of lesions in 79% of the patients [18]. However, we found important differences in DLE doses employed and the administration scheme of both studies. Our results showed colposcopic resolution of cervical lesion in 89% of the patients after 4 weeks of oral treatment with Crocodylus moreletii DLE of 0.3 mg per week, while Rodriguez et al. used a combined therapy of human DLE of 2.2 mg per week, orally for 5 weeks and 2.2 mg at every 72 hr for two weeks used topically. In fact, authors repeated this schedule of treatment when a persistent lesion was found during colposcopy examination. These results suggest that Crocodylus moreletii DLE was more effective than human DLE to treat CIN 1 lesions. Findings from both groups contrast with results obtained by Luciani et al. in 2008 using cervical cryotherapy, an invasive method, in which even though it was effective to diminish the clinical symptoms in 88% of the patients with CIN diagnosis, it could have important side effects such as a profuse watery vaginal discharge for at least 6 weeks [25].

Before treatment, the histopathological analysis of tissue of most samples showed an intense leukocyte infiltration at the cervical stroma, similarly with the findings described by Castle et al. in 2001 [26] and Mirzaie et al. in 2014 [27]. However, after the DLE treatment, a 50% reduction of leukocyte infiltrate was found. The anti-inflammatory effect of DLE was previously reported in 2004 by Orozco and et al., who studied patients diagnosed with atopic dermatitis, reporting that after 10 weeks of DLE treatment, the number of eosinophils was reduced, modifying the inflammatory mediators [9]. In 2005, Ojeda et al. reported that the DLE modulate the production of proinflammatory cytokines in leukocytes activated by the bacterial cell wall components, lipopolysaccharide, lipoteichoic acid, and peptidoglycan, suppressing the production of TNFα, as well as the NF-κB activity inhibition [4]. In our work, we also found that after DLE treatment, a decrease in stromal infiltrating leukocytes could be observed, correlating it with clinical remission of symptoms, strongly suggesting that the mucosal immunity response is enhanced by the DLE treatment, diminishing the inflammatory process. In 2015, Rodriguez et al. reported that the treatment with human DLE in patients with CIN1 decreased viral load [18].

This result is related to our immunohistochemical analysis of the PCNA protein, where we observed a decrease in the cellular proliferation associated with the viral presence.

Thus, we focused our analysis on the evaluation of some specific effector molecules related to the inflammatory/anti-inflammatory processes and the viral persistence. In the cervical mucosae, the microenvironment induced by HPV infection promoted a down-regulation of antigen presentation and the inhibition of activation and migration of Langerhans cells [28], also promoting the imbalance of anti- and pro-inflammatory cytokines, generating inflammation [29][30]. It has been reported that the low expression of TGF-β diminishes macrophages and monocytes chemo-attraction, allowing progression to invasive cervical cancer [31]. Our results suggest that DLE treatment could modify the inflammatory cervix microenvironment, promoting the expression of TGF-β, and probably triggering the synthesis of anti-inflammatory cytokines involved in local immune mechanisms of the cervix. In 2014, Garcia et al. described that DLE directly activated monocytes through TLR-2, suggesting that part of the immunomodulatory properties of DLE could be attributed to TLR-2 activation on monocytes for the control of infectious diseases [5].

On the other hand, it has been documented that IFN-γ expression increases in relation to the grade of cervical injury [32]. These reports are in concordance with our findings showing that before the intervention, an important detection of INF-γ was observed, while after DLE treatment, the INF-γ expression diminished.

Finally, we looked for the detection of IL-32, so it has been documented that it is overexpressed in HPV-positive cervical cancer cells [33], although no evidence has been reported in earlier pre-neoplastic lesions. Besides, in 2014, Zeng et al. demonstrated that IL-32 overexpression contributes to invasion and metastasis in lung adenocarcinoma, promoting cell migration via transactivation of nuclear transcription factor NF-κB pathway [34]. Interestingly, in this work, the expression of IL-32 in the cervix of patients treated with DLE decreased, suggesting that this effect could also diminish the risk of disease progression. In this context, our group reported in 2016 that the administration of DLE promotes the synthesis of anti-inflammatory cytokines in an osteoarthritis disease model, inhibiting the translocation of nuclear transcription factor NF-κB to the nucleus [18]. Taking together the results presented here, we can suggest that DLE treatment could modify the inflammatory status of the cervix mucosae via down-regulation of IL-32.

Conclusion

In conclusion, our results suggest that DLE treatment could modulate the innate immune response in cervical mucosae, diminishing the inflammatory effectors and the clinical symptoms in CIN 1 HPV patients with chronic cervicitis.

Acknowledgements

We would like to thank Lic. Polete Ramirez (Hospital Tláhuac, México) for technical support. This work was supported by Consejo Nacional de Ciencia y Tecnología (México). During this work, MPAR was the recipient of a fellowship from CONACyT (Grant number: 324925).

Conflict of interest

The authors declare no conflict of interest.

Supplementary information

Fig. S1. Representative IFTR profiles of human and crocodile DLE.Table S1. Patients’ demographics.

References

1. Kovacic MB, Katki HA, Kreimer AR, Sherman ME. Epidemiologic analysis of histologic cervical inflammation: relationship to human papillomavirus infections. Hum Pathol. 2008;39(7):1088–1095. [PubMed] [Google Scholar]2. Herbert A, Bergeron C, Wiener H, Schenck U, Klinkhamer P, Bulten J, Arbyn M. European guidelines for quality assurance in cervical cancer screening: recommendations for cervical cytology terminology. Cytopathology. 2007;18(4):213–219. [PubMed] [Google Scholar]3. Dasari P, Rajathi S, Kumar SV. Colposcopic evaluation of cervix with persistent inflammatory Pap smear: A prospective analytical study. Cytojournal. 2010;7:16–16. [PMC free article] [PubMed] [Google Scholar]4. Ojeda MO, van’t Veer C, Fernández Ortega CB, Araña Rosainz Mde J, Buurman WA. Dialyzable leukocyte extract differentially regulates the production of TNFalpha, IL-6, and IL-8 in bacterial component-activated leukocytes and endothelial cells. Inflamm Res. 2005;54(2):74–81. [PubMed] [Google Scholar]5. García-Hernández U, Robledo-Avila FH, Alvarez-Jiménez VD, Rodríguez-Cortés O, Wong-Baeza I, Serafín-López J, Aguilar-Anguiano LM, Estrada-Parra S, Estrada-García I, Pérez-Tapia SM, Chacón-Salinas R. Dialyzable leukocyte extracts activate TLR-2 on monocytes. Nat Prod Commun. 2014;9(6):853–856. [PubMed] [Google Scholar]6. Armides Franco-Molina M, Mendoza-Gamboa E, Castillo-Tello P, Tamez-Guerra RS, Villarreal-Treviño L, Tijerina-Menchaca R, Castillo-León L, Zapata-Benavides P, Rodríguez-Padilla C. In vitro antibacterial activity of bovine dializable leukocyte extract. Immunopharmacol Immunotoxicol. 2006;28(3):471–483. [PubMed] [Google Scholar]8. Vacek A, Hofer M, Hromas J, Luksíková E, Svoboda J, Schneiderová H. Hemopoiesis-stimulating effects and enhanced survival of irradiated mice after peroral or intraperitoneal administration of ultrafiltered pig leukocyte extract (UPLE, IMUNOR) Immunopharmacol Immunotoxicol. 2002;24(4):651–664. [PubMed] [Google Scholar]9. Orozco T, Solano M, Sandoval G, Vera J, Parra S. Inflammatory mediators in patients with atopic dermatitis after treatment with transfer factor. Rev Alerg Mex. 2004;51:151–154. [PubMed] [Google Scholar]10. Franco-Molina MA, Mendoza-Gamboa E, Castillo-León L, Tamez-Guerra RS, Rodríguez-Padilla C. Bovine dialyzable leukocyte extract protects against LPS-induced, murine endotoxic shock. Int Immunopharmacol. 2004;4(13):1577–1586. [PubMed] [Google Scholar]11. Ojeda MO, Fernández C, Rosaínz MJ. Dialyzable leukocyte extract suppresses the activity of essential transcription factors for HIV-1 gene expression in unstimulated MT-4 cells. Biochem Biophys Res Commun. 2000;14:1099–1103. [PubMed] [Google Scholar]12. Vacek A, Hofer M, Barnet K, Cech K, Pekárek J, Schneiderová H. Positive effects of dialyzable leukocyte extract (DLE) on recovery of mouse haemopoiesis suppressed by ionizing radiation and on proliferation of haemopoietic progenitor cells in vitro. Int J Immunopharmacol. 2000;22(8):623–634. [PubMed] [Google Scholar]13. Viza D, Fudenberg HH, Palareti A, Ablashi D, De Vinci C, Pizza G. Transfer factor: an overlooked potential for the prevention and treatment of infectious diseases. Folia Biol (Praha) 2013;59(2):53–67. [PubMed] [Google Scholar]14. Fabre RA, Pérez TM, Aguilar LD, Rangel MJ, Estrada-Garcìa I, Hernández-Pando R, Estrada Parra S. Transfer factors as immunotherapy and supplement of chemotherapy in experimental pulmonary tuberculosis. Clin Exp Immunol. 2004;136(2):215–223. [PMC free article] [PubMed] [Google Scholar]15. Lara HH, Turrent LI, Garza-Treviño EN, Tamez-Guerra R, Rodriguez-Padilla C. Clinical and immunological assessment in breast cancer patients receiving anticancer therapy and bovine dialyzable leukocyte extract as an adjuvant. Exp Ther Med. 2010;1(3):425–431. [PMC free article] [PubMed] [Google Scholar]16. Franco-Molina MA, Mendoza-Gamboa E, Miranda-Hernández D, Zapata-Benavides P, Castillo-León L, Isaza-Brando C, Tamez-Guerra RS, Rodríguez-Padilla C. In vitro effects of bovine dialyzable leukocyte extract (bDLE) in cancer cells. Cytotherapy. 2006;8(4):408–414. [PubMed] [Google Scholar]17. Franco-Molina MA, Mendoza-Gamboa E, Zapata-Benavides P, Vera-García ME, Castillo-Tello P, García de la Fuente A, Mendoza RD, Garza RG, Támez-Guerra RS, Rodríguez-Padilla C. IMMUNEPOTENT CRP (bovine dialyzable leukocyte extract) adjuvant immunotherapy: a phase I study in non-small cell lung cancer patients. Cytotherapy. 2008;10(5):490–496. [PubMed] [Google Scholar]18. Rodriguez-Flores A, Nuñez-Fernandez G, Estrada-Garcia I, Aguilar-Santelises M, Rojas-Espinosa O, Estrada-Parra S. Adjuvant treatment with a dialyzable leukocytes extract contributes to maintain HPV-infected women free of low-grade cervical lesions. Eur J Gynaecol Oncol. 2015;36(6):655–661. [PubMed] [Google Scholar]19. Acosta P, Pérez N, Pérez E, Correa B, Pérez C, Gómez C, Sánchez V, Pérez DG. Anti-inflammatory effect of dialysable leucocyte extract in a rat model of osteoarthritis: histopathological and molecular characterization. Scand J Rheumatol. 2016;45(6):528–535. [PubMed] [Google Scholar]20. Pérez-Alvarado C, Gómez C, Reyes M, García M, Pérez E, Pérez de la Mora C, Sanchez V, Pérez Ishiwara DG. Anti-Inflammatory Effect of Dialyzable Leukocyte Extract in Autoimmune Prostatitis: Evaluation in Animal Model. Biomed Res Int. 2017;20171832853 [PMC free article] [PubMed] [Google Scholar]21. Boccardo E, Lepique AP, Villa LL. The role of inflammation in HPV carcinogenesis. Carcinogenesis. 2010;31(11):1905–1912. [PubMed] [Google Scholar]22. Deligeoroglou E, Giannouli A, Athanasopoulos N, Karountzos V, Vatopoulou A, Dimopoulos K, Creatsas G. HPV infection: immunological aspects and their utility in future therapy. Infect Dis Obstet Gynecol. 2013;2013540850 [PMC free article] [PubMed] [Google Scholar]232. Liu M, Acres B, Balloul JM, Bizouarne N, Paul S, Slos P, Squiban P. Gene-based vaccines and immunotherapeutics. Proc Natl Acad Sci U S A. 2004;101 Suppl 2:14567–14571. [PMC free article] [PubMed] [Google Scholar]24. Gillet E, Meys JF, Verstraelen H, Bosire C, De Sutter P, Temmerman M, Broeck DV. Bacterial vaginosis is associated with uterine cervical human papillomavirus infection: a meta-analysis. BMC Infect Dis. 2011;1110 [PMC free article] [PubMed] [Google Scholar]25. Luciani S. Effectiveness of cryotherapy treatment for cervical intraepithelial neoplasia. Int J Gynaecol Obstet. 2008;101:172–177. [PubMed] [Google Scholar]26. Castle PE, Hillier SL, Rabe LK, Hildesheim A, Herrero R, Bratti MC, Sherman ME, Burk RD, Rodriguez AC, Alfaro M, Hutchinson ML, Morales J, Schiffman M. An association of cervical inflammation with high-grade cervical neoplasia in women infected with oncogenic human papillomavirus (HPV) Cancer Epidemiol Biomarkers Prev. 2001;10(10):1021–1027. [PubMed] [Google Scholar]27. Mirzaie-Kashani E, Bouzari M, Talebi A, Arbabzadeh-Zavareh F. Detection of Human Papillomavirus in Chronic Cervicitis, Cervical Adenocarcinoma, Intraepithelial Neoplasia and Squamous Cell Carcinoma. Jundishapur J Microbiol. 2014;7:1–5. [PMC free article] [PubMed] [Google Scholar]28. Amador A, Hernández JF, Lamoyi E, Contreras A, Lizano M. Role of Innate Immunity against Human Papillomavirus (HPV) Infections and Effect of Adjuvants in Promoting Specific Immune Response. Viruses. 2013;5:2624–2642. [PMC free article] [PubMed] [Google Scholar]29. Giannini SL, Hubert P, Doyen J, Boniver J, Delvenne P. Influence of the mucosal epithelium microenvironment on Langerhans cells: implications for the development of squamous intraepithelial lesions of the cervix. Int J Cancer. 2002;97(5):654–659. [PubMed] [Google Scholar]30. Pardo-Govea T, Callejas D, Núñez-Troconis J, Araujo M, Costa L, Pons H, Delgado M, Monsalve F. Gamma interferon (IFN-gamma), tumor necrosis factor alpha (TNF-alpha) and interleukins 2, 4 and 6 (IL-2, IL-4, IL-6) in cervical-uterine cells of intraepithelial neoplasia: a preliminary report. Invest Clin. 2005;46(1):5–13. [PubMed] [Google Scholar]31. Wu HS, Li YF, Chou CI, Yuan CC, Hung MW, Tsai LC. The concentration of serum transforming growth factor beta-1 (TGF-beta1) is decreased in cervical carcinoma patients. Cancer Invest. 2002;20(1):55–59. [PubMed] [Google Scholar]32. Hu T, Yang P, Zhu H, Chen X, Xie X, Yang M, Liu S, Wang H. Accumulation of invariant NKT cells with increased IFN-γ production in persistent high-risk HPV-infected high-grade cervical intraepithelial neoplasia. Diagn Pathol. 2015;1020 [PMC free article] [PubMed] [Google Scholar]33. Kim LJ, Kim H, Kang J, Kim S, Yang Y, Kim J, Park J, Park S, Hong J, Yoon D. Activation of the interleukin-32 pro-inflammatory pathway in response to human papillomavirus infection and over-expression of interleukin-32 controls the expression of the human papillomavirus oncogene. Immunology. 2011;132:410–420. [PMC free article] [PubMed] [Google Scholar]34. Zeng Q, Li S, Zhou Y, Ou W, Cai X, Zhang L, Huang W, Huang L, Wang Q. Interleukin-32 contributes to invasion and metastasis of primary lung adenocarcinoma via NF-kappa B induced matrix metalloproteinases 2 and 9 expression. Cytokine. 2014;65(1):24–32. [PubMed] [Google Scholar]

Effect of Dialyzable Leukocyte Extract on chronic cervicitis in patients with HPV infection

J Med Life. 2017 Oct-Dec; 10(4): 237–243.

,^*,^**,^*,^***,^*,^****,^*****,^*,^******,^******* and ^*

MP Acosta-Rios

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

E Sauer-Ramírez

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

LJ Castro-Muñoz

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

M García-Solís

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

C Gómez-García

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

R Ocadiz-Delgado

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

A Martinez-Martinez

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

V Sánchez-Monroy

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

C Pérez-De la Mora

^******FARMAINMUNE, Azcapotzalco Mexico

B Correa-Meza

^*******BIOXPORT, Azcapotzalco Mexico

DG Perez-Ishiwara

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

^******FARMAINMUNE, Azcapotzalco Mexico

^*******BIOXPORT, Azcapotzalco Mexico

Received 2017 Nov 24; Accepted 2017 Dec 19.

Supplementary Materials

Fig. S1. Representative IFTR profiles of human and crocodile DLE.

GUID: D1E06B72-5901-42C7-9CEE-F719326B7739

Table S1. Patients’ demographics.

GUID: 3648694E-D60C-4CCB-B730-2B7A5AFCCE00

Abstract

Trial registration: Register ISRCTN16429164

Abbreviations:
HPV = Human Papilloma Virus; DLE = Dialyzable leukocyte extract

Keywords: HPV, DLE, chronic cervicitis

Introduction

Material and Methods

At the end of the treatment patients were clinically evaluated again and assessed by colposcopy, and cervical samples were taken for both histopathological and immunohistochemical analyses.

Results

Table 1

Clinical evaluation of experimental groups

Symptoms	Number of Patients
	DLE treatment		Placebo treatment
	Before	After	Before	After
White vaginal fluid	11	1	8	8
Bleeding	0	0	0	0
Pelvic Pain	4	1	2	2
Recurrent urinary tract infection	7	0	3	3

Treatment

Discussions

This result is related to our immunohistochemical analysis of the PCNA protein, where we observed a decrease in the cellular proliferation associated with the viral presence.

Conclusion

Acknowledgements

Conflict of interest

The authors declare no conflict of interest.

Supplementary information

Fig. S1. Representative IFTR profiles of human and crocodile DLE.Table S1. Patients’ demographics.

References

Effect of Dialyzable Leukocyte Extract on chronic cervicitis in patients with HPV infection

J Med Life. 2017 Oct-Dec; 10(4): 237–243.

,^*,^**,^*,^***,^*,^****,^*****,^*,^******,^******* and ^*

MP Acosta-Rios

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

E Sauer-Ramírez

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

LJ Castro-Muñoz

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

M García-Solís

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

C Gómez-García

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

R Ocadiz-Delgado

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

A Martinez-Martinez

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

V Sánchez-Monroy

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

C Pérez-De la Mora

^******FARMAINMUNE, Azcapotzalco Mexico

B Correa-Meza

^*******BIOXPORT, Azcapotzalco Mexico

DG Perez-Ishiwara

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

^******FARMAINMUNE, Azcapotzalco Mexico

^*******BIOXPORT, Azcapotzalco Mexico

Received 2017 Nov 24; Accepted 2017 Dec 19.

Supplementary Materials

Fig. S1. Representative IFTR profiles of human and crocodile DLE.

GUID: D1E06B72-5901-42C7-9CEE-F719326B7739

Table S1. Patients’ demographics.

GUID: 3648694E-D60C-4CCB-B730-2B7A5AFCCE00

Abstract

Trial registration: Register ISRCTN16429164

Abbreviations:
HPV = Human Papilloma Virus; DLE = Dialyzable leukocyte extract

Keywords: HPV, DLE, chronic cervicitis

Introduction

Material and Methods

At the end of the treatment patients were clinically evaluated again and assessed by colposcopy, and cervical samples were taken for both histopathological and immunohistochemical analyses.

Results

Table 1

Clinical evaluation of experimental groups

Symptoms	Number of Patients
	DLE treatment		Placebo treatment
	Before	After	Before	After
White vaginal fluid	11	1	8	8
Bleeding	0	0	0	0
Pelvic Pain	4	1	2	2
Recurrent urinary tract infection	7	0	3	3

Treatment

Discussions

This result is related to our immunohistochemical analysis of the PCNA protein, where we observed a decrease in the cellular proliferation associated with the viral presence.

Conclusion

Acknowledgements

Conflict of interest

The authors declare no conflict of interest.

Supplementary information

Fig. S1. Representative IFTR profiles of human and crocodile DLE.Table S1. Patients’ demographics.

References

Effect of Dialyzable Leukocyte Extract on chronic cervicitis in patients with HPV infection

J Med Life. 2017 Oct-Dec; 10(4): 237–243.

,^*,^**,^*,^***,^*,^****,^*****,^*,^******,^******* and ^*

MP Acosta-Rios

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

E Sauer-Ramírez

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

LJ Castro-Muñoz

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

M García-Solís

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

C Gómez-García

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

R Ocadiz-Delgado

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

A Martinez-Martinez

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

V Sánchez-Monroy

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

C Pérez-De la Mora

^******FARMAINMUNE, Azcapotzalco Mexico

B Correa-Meza

^*******BIOXPORT, Azcapotzalco Mexico

DG Perez-Ishiwara

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

^******FARMAINMUNE, Azcapotzalco Mexico

^*******BIOXPORT, Azcapotzalco Mexico

Received 2017 Nov 24; Accepted 2017 Dec 19.

Supplementary Materials

Fig. S1. Representative IFTR profiles of human and crocodile DLE.

GUID: D1E06B72-5901-42C7-9CEE-F719326B7739

Table S1. Patients’ demographics.

GUID: 3648694E-D60C-4CCB-B730-2B7A5AFCCE00

Abstract

Trial registration: Register ISRCTN16429164

Abbreviations:
HPV = Human Papilloma Virus; DLE = Dialyzable leukocyte extract

Keywords: HPV, DLE, chronic cervicitis

Introduction

Material and Methods

At the end of the treatment patients were clinically evaluated again and assessed by colposcopy, and cervical samples were taken for both histopathological and immunohistochemical analyses.

Results

Table 1

Clinical evaluation of experimental groups

Symptoms	Number of Patients
	DLE treatment		Placebo treatment
	Before	After	Before	After
White vaginal fluid	11	1	8	8
Bleeding	0	0	0	0
Pelvic Pain	4	1	2	2
Recurrent urinary tract infection	7	0	3	3

Treatment

Discussions

This result is related to our immunohistochemical analysis of the PCNA protein, where we observed a decrease in the cellular proliferation associated with the viral presence.

Conclusion

Acknowledgements

Conflict of interest

The authors declare no conflict of interest.

Supplementary information

Fig. S1. Representative IFTR profiles of human and crocodile DLE.Table S1. Patients’ demographics.

References

Effect of Dialyzable Leukocyte Extract on chronic cervicitis in patients with HPV infection

J Med Life. 2017 Oct-Dec; 10(4): 237–243.

,^*,^**,^*,^***,^*,^****,^*****,^*,^******,^******* and ^*

MP Acosta-Rios

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

E Sauer-Ramírez

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

LJ Castro-Muñoz

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

M García-Solís

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

C Gómez-García

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

R Ocadiz-Delgado

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

A Martinez-Martinez

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

V Sánchez-Monroy

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

C Pérez-De la Mora

^******FARMAINMUNE, Azcapotzalco Mexico

B Correa-Meza

^*******BIOXPORT, Azcapotzalco Mexico

DG Perez-Ishiwara

^*PLaboratory of Molecular Biomedicine I, ENMyH, Instituto Politécnico Nacional, Mexico

^**Mexican College of Obstetrics and Gynecology Specialists, A.C. Mexico

^***Hospital General de Milpa Alta, Mexico City SSA, Mexico

^****Department of Genetics and Molecular Biology, Centro de Investigación y de Estudios Avanzados IPN, Mexico

^*****Department of Chemical and Biological Sciences, Universidad Autónoma de Ciudad Juarez, Mexico

^******FARMAINMUNE, Azcapotzalco Mexico

^*******BIOXPORT, Azcapotzalco Mexico

Received 2017 Nov 24; Accepted 2017 Dec 19.

Supplementary Materials

Fig. S1. Representative IFTR profiles of human and crocodile DLE.

GUID: D1E06B72-5901-42C7-9CEE-F719326B7739

Table S1. Patients’ demographics.

GUID: 3648694E-D60C-4CCB-B730-2B7A5AFCCE00

Abstract

Trial registration: Register ISRCTN16429164

Abbreviations:
HPV = Human Papilloma Virus; DLE = Dialyzable leukocyte extract

Keywords: HPV, DLE, chronic cervicitis

Introduction

Material and Methods

At the end of the treatment patients were clinically evaluated again and assessed by colposcopy, and cervical samples were taken for both histopathological and immunohistochemical analyses.

Results

Table 1

Clinical evaluation of experimental groups

Symptoms	Number of Patients
	DLE treatment		Placebo treatment
	Before	After	Before	After
White vaginal fluid	11	1	8	8
Bleeding	0	0	0	0
Pelvic Pain	4	1	2	2
Recurrent urinary tract infection	7	0	3	3

Treatment

Discussions

This result is related to our immunohistochemical analysis of the PCNA protein, where we observed a decrease in the cellular proliferation associated with the viral presence.

Conclusion

Acknowledgements

Conflict of interest

The authors declare no conflict of interest.

Supplementary information

Fig. S1. Representative IFTR profiles of human and crocodile DLE.Table S1. Patients’ demographics.

References

Endocervicitis and cervicitis | TS Clinic – Krasnodar

The problem of inflammatory diseases of the genital organs in women is very relevant today, since they account for more than half of all visits to gynecologists. The most common pathologies in this group are endocervicitis and cervicitis. These diseases have similar symptoms and causes.

The main difference between them is the localization of the pathological process in the cervix. Endocervicitis is an isolated inflammation of the mucous membrane of its canal (cervical), and cervicitis is also internal tissues.

Causes of the disease

The inflammatory process in the cervical region develops under the influence of certain infectious agents. Disease can be caused by both opportunistic microorganisms (which normally do not harm, but exhibit pathogenic properties with a decrease in the body’s resistance), and causative agents of sexually transmitted infections (chlamydia, gonococcus, Trichomonas, etc.). Chronic cervicitis in 80% of cases is combined with human papillomavirus infection.

The main factors that contribute to the onset of an inflammatory process in the cervix are:

Intrauterine interventions: abortion, invasive diagnostic procedures, surgical manipulations with the expansion of the cervical canal
Injuries during childbirth
Inflammatory diseases of other organs of the genitourinary system (vulvovaginitis, endometritis, cystitis, etc.)
Promiscuous sex life without the use of barrier-type contraceptives
Decrease in the body’s immune defense in case of concomitant diseases of other organs and systems; taking immunosuppressive therapy.

Possible reasons for the development of endocervicitis also include allergic reactions to the use of chemical spermicides, poor-quality condoms. An intrauterine device can also cause irritation of the mucous membrane. With menopause, the appearance of inflammation is facilitated by atrophic changes in the inner lining of the cervical canal.

Clinical picture

The main symptom that in most cases accompanies inflammation of the cervix is a change in the amount and characteristics of discharge. In an acute pathological process, they become abundant, cloudy, liquid or viscous, mucous or purulent in nature. Another common symptom of cervicitis and endocervicitis is moderate pain in the lower abdomen at rest or during intercourse.

The severity and nature of symptoms largely depends on the causative agent of the disease.For example, chlamydial cervicitis, as a rule, is almost asymptomatic, and gonorrheal is accompanied by a vivid inflammatory reaction.

In the presence of concomitant inflammatory diseases of the genitourinary organs, the symptoms become more varied. Most often, both endocervicitis and cervicitis are accompanied by vulvovaginitis. In this case, the patient will be bothered by itching, burning and redness of the external genitalia, painful urination.

If a woman did not seek medical help on time or received the wrong treatment, the inflammatory process can become chronic.In this case, the clinical manifestations of the disease subside or completely disappear. Exacerbation of chronic cervicitis can provoke hypothermia, infection, change of sexual partner, severe stress.

Diagnostics

If you suspect the presence of endocervicitis or cervicitis, the gynecologist prescribes a comprehensive examination, which includes the following methods:

Examination in the mirrors. Redness of the cervix is detected, discharge may be noticeable.Touching with a tampon often results in bleeding. With endocervicitis, a bright red rim is determined around the internal os of the cervix
Collection and microscopy of a smear from the vagina. The number of leukocytes in the biomaterial and the possible presence of pathogenic microflora (candida, gonococcus, etc.) are assessed.
Colposcopy. Examination of the cervix under magnification reveals signs of inflammation that are not visible to the naked eye
Cytological analysis of a vaginal smear.Helps to determine the depth of the spread of the inflammatory process. This study is also used to monitor the effectiveness of treatment

To identify a specific microorganism that caused inflammation of the cervix, and determine its sensitivity to a particular type of antibiotic therapy, a cervical smear is cultured. Also, to detect specific infectious agents, diagnostic methods such as PCR and ELISA can be used.

Treatment

The goal of cervicitis treatment is to suppress inflammation with antibacterial, antiviral or antifungal therapy (depending on the cause of the disease). In each case, the means of local or systemic action are selected individually.

If a sexually transmitted infection is detected, a dermatovenerologist is involved in the treatment process. Therapy is mandatory not only for the woman, but also for her sexual partner.

As part of complex treatment, immunostimulating drugs are often used, which increase the general resistance of the body. Also, in order to increase the effectiveness of therapy, physiotherapeutic methods can be used: UHF and UFO.

Cervical ablation can be used to treat recurrent cervicitis. The most effective is an integrated approach, within the framework of which a treatment is selected that is aimed both at eliminating the main symptoms of the disease and at eliminating its causes.

symptoms, diagnosis and treatment of cervicitis – Women’s Medical Center MedOK

Depending on the area of the cervix of the uterus, the inflammatory focus is formed, cervicitis is divided into two types:

1. Exocervicitis is a disease in which inflammation occurs in the vaginal region of the cervix. It can be detected during a standard gynecological examination.

2. Inflammation of the cervical canal is called “endocervicitis”. This type of disease is quite difficult to detect during a routine examination.Additional tests and observation of characteristic symptoms are required.

By the nature of the course, the disease is divided into: acute and chronic cervicitis. In acute cervicitis, mucous or purulent discharge from the vagina, pain in the lower abdomen, disturb. The appearance of other symptoms of cervicitis may be associated with concomitant diseases of the genitourinary sphere: endometritis, salpingo-oophoritis, urethritis, adnexitis.

Chronic cervicitis usually develops against the background of inflammatory diseases and untreated primary cervicitis.In chronic cervicitis, thickening and hypertrophy of the cervix occurs, which is facilitated by small cysts formed during the healing of cervical erosions. The occurrence of chronic cervicitis is very often promoted by the defeat of the mucous membrane of the cervix with colpitis, especially long-term and recurrent periodically. Allocate atrophic cervicitis, accompanied by atrophy of the cervical mucosa. Exacerbations can occur during the occurrence of adverse factors (weakening of the immune system, hormonal disorders, infections).

Chronic cervicitis means that the infection that provoked it, most likely entered the body for a long time and is currently developing slowly, gradually destroying the tissues of the cervix.

By prevalence: focal and diffuse.

By etiology: specific (caused by STD pathogens: chlamydia, gonorrheal, tuberculous, syphilitic; viruses: herpetic, caused by HPV-condylomatous) and nonspecific, due to the influence of opportunistic microorganisms.Purulent cervicitis – means that against the background of inflammation in the cervical canal of a woman, pus is formed. Purulent cervicitis especially often occurs against the background of gonorrhea. Distinguish also:

cystic chronic cervicitis with the formation of nabotovye cysts;
cervicitis with cervical hypertrophy;
lymphocytic (lymphocytic infiltration of the walls of the cervix with the formation of follicular centers under the endocervical epithelium-follicular cervicitis, or without their formation.These are benign changes. It occurs mainly in postmenopausal women and is not accompanied by symptoms.

Cervicitis can also result from damage to the cervix during childbirth and abortion. Sometimes cervicitis is caused by concentrated solutions of potassium permanganate, iodine and other substances introduced into the vagina and cervix for medicinal purposes or to terminate pregnancy.

In the acute form of cervicitis, general edema and an increase in the cervix are observed.The mucous membrane of the vaginal part of the cervix is bright red. Discharge from the cervix increases and is mucopurulent. The temperature remains normal or subfebrile for several days. Pain in the sacrum, in the lower abdomen, radiating to the hips and anus, is unstable. Acute symptoms gradually disappear within 1-2 weeks, and cervicitis becomes a chronic phase. Discharge from the cervical canal gradually decreases, becomes less viscous and lighter.

The amount of purulent elements also decreases, and the discharge takes on a slimy character.

Microbial flora is also gradually becoming scarce. However, a significant decrease and even a complete temporary disappearance of secretions and the scarcity of microbial flora are not a sign of the disappearance of the infection. The latter can nest in the deep parts of the cervical tissue and give an exacerbation of the process during the next menstruation, after vaginal examination and other manipulations in the vagina and cervix.

Cervicitis associated with rupture of the cervix during abortion and childbirth, usually occurs in a subacute and chronic form.The round shape of the external pharynx is disturbed: the front and back lips diverge at the rupture site, the mucous membrane of the cervical canal turns outward and an eversion (ectropion) is formed. The non-physiological state of tissues in the area of eversion leads to increased secretion of the mucous membrane and a chronic inflammatory process in all tissues of the cervix with the formation of dense scar tissue in the area of eversion. There are enlarged glands with a closed excretory duct and an accumulation of a detachable gland (ovula Nabothi).In these glands, infection (virulent microflora) can persist for a long time.

(PDF) [THE EFFICIENCY OF HPV-ASSOCIATED CERVICITIS TREATMENT]

Problems of reproduction, 5, 2011

of structural treatment, which indicated the per-

HPV systitis and the possibility of recurrence of the disease

In parallel, a comparative assessment of

anamnestic and clinical indicators of patients with chronic HPV-associated cervical

cytes with healthy women was carried out.

For this purpose, an additional control group was created

, which consisted of 30 patients,

who applied to the antenatal clinic for prophylactic

lactic examination. The main

group consists of 60 patients with chronic cer-

vicitis associated with HPV.

The surveyed women of the main and control

groups were identical in age (mean

age 29.8 ± 0.9 years).

Patients of the main group presented with a sting –

would be on pathological discharge from the genital tract

– 22 (36.6%) women, itching – 20 (33.3%), burning –

15 (25.0%) , contact bleeding – 8 (13.3%),

feeling of discomfort in the external genital area

organs – 15 (25.0%), dysuric disorders –

5 (8.3%), recurrent pain in the lower abdomen – 4

(6.6%). 14 (23.3%) women had no complaints. Patients

of the control group did not have any active complaints,

, but 4 (6.6%) had discomfort in the vulva area in 4 (6.6%) of the survey.

The somatic and obstetric-gynecological history of the examined patients was specified. In the study of bad habits

, smoking more than 5 cigarettes

per day was observed in 23 (38.3%) patients of the main

group and 3 (10.0%) in the control group (p <0.05). X-

diffuse enlargement of the thyroid gland of the I-III degree, typical for the Ural region, without impairment of function

, took place in 12 (20.0%) patients

of the main group and in 5 (16.6% ) – in the control group.

Chronic bronchitis, chronic tonsillitis, pye-

lonephritis was found in the main group in 1.7, 1.7,

3.3% of patients, respectively, which did not differ significantly from the indicators in the control group (3 , 3, 3.3,

6.6%, respectively).

Early sexual debut was noted by 38 (63.3%) female

women from the main group and 5 (16.6%) women from the control group

trolls (p <0.05). The average age of sexual debut -

– in the study group was 16.8 ± 1.2 years, in the

control group – 18.1 ± 0.5 years.The total number of

sexual partners during life in the

main group is determined as follows:

up to 5 partners – in 9 (15.0%) patients, up to 10 – in 25

(41.7%), up to 20 – in 21 (35.0%), more than 30 – in 5 (8.3%).

In the control group, these indicators were 17

(56.7%), 10 (33.3%), 2 (6.7%), 1 (3.3%), respectively –

but, which indicates the influence of sexual management on the emergence and activation of papilloma-

viral infection and is consistent with the data of domestic and foreign researchers [1, 11, 15].

During the last year before the study, there were more than 5 sexual partners in 22 (36.6%)

women in the main group, in 3 (10.0%) – control –

group (p < 0.001).

When studying the menstrual function, no significant differences in the age of onset and formation of menarche were revealed. Soreness of menstruation –

– was noted by 23 (38.3%) patients of the main group –

p, which may be associated with chronic inflammation –

pulmonary diseases of the pelvic organs.

In the analysis of reproductive function, it was revealed

but that artificial abortions were reliably more often

in the history of patients of the main group –

p – in 29 (48.3%) compared with the control group –

p – in 8 (26.6%). 19 (31.6%) women of the main

group had no pregnancy history. Of these,

4 (6.6%) women had infertility. Analysis of

gynecological morbidity in the main group

ne revealed: cervicitis – in 29 (48.3%) women,

chronic endometritis – in 2 (3.3%), chronic

adnexitis – in 15 (25 %), functional ovarian cysts –

– in 3 (5.0%), uterine myoma – in 2 (3.3%), endo-

metriosis – in 2 (3.3%).In the control group, 5 (16.7%)

women indicated the presence of cervicitis, 1 (3.3%)

– endometriosis, 1 (3.3%) – ovarian cyst. Of the

fections of the genital tract, most often the patients

of the main group noted a history of urea –

mycoplasma infection – 29 (48.3%), urogenic –

tal trichomoniasis – 19 (31.6%), candidiasis – 15

(25.0%), bacterial vaginosis – 12 (20%). In the

trol group, 11 (36.6%) women indicated the presence of bacterial vaginosis in the past

, and

(15%) – vaginal candidiasis.

When examining with mirrors in patients

the current of the main group revealed: hyperemia of the walls

of the vagina – in 22 (36.6%) patients, purulent discharge –

in the posterior fornix of the vagina – in 5 (8.3 %), moderate –

renal mucopurulent – in 45 (70.0%). Hyper-

mia around the cervical canal was recorded in

51 (85%) women (in 25 (83.3%) – in the main group –

ne), 26 (86.6%) – in the control group, hyperemia

exocervix, uneven coloration of the mucous membrane

of the cervix was observed in 44 (73.3%) women (in 23

(76.6%) – in the main group, in 21 (70.0%) – in the end –

trol group.Ectopic columnar epithelium

of the cervical canal was visualized in 23

(38.3%) women, in 12 (40%) – in the main group, in

11 (36.7%) – in the control group. In the control group

, no pathological changes were detected during visual

examination. Ectopia was diagnosed with

in 11 (36.6%) women.

Microscopic examination of material

from the posterolateral fornix of the vagina revealed

signs of inflammation in 22 (36.6%) patients in the main

group: in 18 (30.0%) women, the number of leuko-

cytes was 40-60 in the field of view, in 4 (6.7%) women –

– more than 61.In the cervical canal, from 40 to 60

leukocytes in the field of view were detected in 45 (75.0%)

Cervicitis

More and more often girls and young women come to the reception with complaints of uncomfortable discharge from the genital tract. With a detailed and thorough examination, the diagnosis of Cervicitis is often made.

Cervicitis – an inflammatory process of the cervix. It manifests itself as cloudy (mucous or purulent) discharge, pulling pains in the lower abdomen, periodic painful urination and / or intercourse.
The cervix is a protective barrier that prevents infection from entering the uterus and upper genitals. Under certain factors, such as, for example, the addition of a nonspecific infection, birth trauma, damage to the mucous membrane during diagnostic curettage, abortion, installation and / or removal of the IUD, there is a violation of its protective function, the penetration of foreign microflora and the development of an inflammatory process – Cervicitis.
Cervicitis can occur when infected with pathogenic microflora: staphylococcus, streptococcus, E.coli, mushrooms p. Candida, Chlamydia, Mycoplasma, Trichomonas, viruses, including HPV. The microflora that causes cervicitis enters the cervix by contact from the rectum, either through the blood and lymph, or through sexual contact.

Other diseases of the genitourinary system also contribute to the development of cervicitis: vulvitis, vaginitis, ectropion, etc.

Cervicitis, not detected or untreated in the acute stage, becomes a chronic process. The discharge becomes cloudy, slimy, sometimes with an unpleasant odor.Revealed pseudo-erosion on the vaginal part of the uterus.
For the timely diagnosis of chronic cervicitis, it is necessary to undergo an initial gynecological examination, video colposcopy and pass the necessary tests.

Treatment of cervicitis depends on the etiology of the disease. The required scope of examination and treatment is selected strictly individually by the doctor. You should not delay visiting a gynecologist for the most effective, high-quality and timely examination. Health to you!

Medical Center Axon

Genital warts are single or multiple formations on the genitals, of various sizes and shapes, often similar to cauliflower, located on a stalk or on a broad base.

Manifestations of the disease

Formations appear on the skin and mucous membrane of the genital organs, causing not only aesthetic, but also physical discomfort. Warts often bleed during contact with clothing, hygiene procedures and sexual intercourse. There is often a tendency towards growth and dissemination.
Viral cervicitis and vaginitis are the reason for frequent visits of patients to doctors with complaints of discomfort caused by itching, burning sensation, profuse discharge, recurrent bacterial vaginosis and candidiasis.In most cases, these patients experience exacerbation of clinical symptoms before each menstruation.

Factors contributing to the disease

The appearance of genital warts is always associated with increased viral activity (HPV). There are about 300 million people infected with HPV in the world. PVI (human papillomavirus infection) of the genitals was detected in 30.3% of the population of the European part of the Russian Federation. The peak incidence of papillomavirus infection (PVI) of the genital organs is recorded in 15-25-year-old sexually active women.Three years after the onset of sexual activity, 70% of women are infected with HPV. The incidence of human papillomavirus infection (PVI) is directly proportional to the number of sexual partners.
More than 100 types of HPV are known, about 80 types are described in detail. Of all the identified types, 34 affect the anogenital region. Different types of human papillomavirus can cause the appearance of moles, warts, papillomas, areas of hyperkeratosis, etc. Some types of this virus cause genital warts. These types are transmitted only sexually, therefore genital warts belong to the group of STDs.
Each warts is a reservoir for the human papillomavirus. This virus also accumulates in the tissues surrounding the warts. Its high concentration can cause changes in the DNA of the cells of the epithelium of the skin or mucous membranes of the genital organs, as a result of which precancerous conditions often develop. The International Agency for Research on Cancer has declared HPV types 16 and 18 to be carcinogenic, and types 31, 33 and 35 as possible carcinogens.


genital warts	perineal warts	human papillomavirus

Classification of human papillomavirus infection (HPV)

Clinical forms (visible to the naked eye):

• Exophytic warts (genital warts, papillary, papular).
• Symptomatic CIN (cervical intraepithelial neoplasia).
Subclinical forms (invisible to the naked eye and asymptomatic, detectable only by colposcopy and / or by cytological or histological examination):
• Flat warts (typical structure with many coilocytes).
• Small forms (various lesions of stratified squamous and metaplastic epithelium with single coilocytes).
• Inverting warts (with localization in crypts).
• Condylomatous cervicitis / vaginitis.
Latent forms (detection of HPV DNA in the absence of clinical, morphological or histological changes):
• CIN (cervical intraepithelial neoplasia):
• CIN I – mild dysplasia
• CIN II – severe dysplasia
• CIN III – severe dysplasia situ (cancer in situ)
• microinvasive squamous cell carcinoma

Prevention of human papillomavirus infection (HPV)

• Barrier methods of contraception.
• Vaccination against highly oncogenic HPV types at risk of developing cervical cancer.
• Targeted counseling for women at risk of developing PVI.
• Quitting smoking.

Treatment

Radiosurgical removal of genital warts. With this method, genital warts are removed with a special device for radio wave surgery (surgitron), in which the tissue is cut with a narrowly directed beam of high frequency radio waves.

Conference program 11 February 2016

VII CONFERENCE ON DISEASES OF THE CERVICAL UTERINE

The cervix as a mirror of the inflammatory process of the genitals.

11 February 2016

from 10.00 to 16.00 conference hall LOKB

Chairs:

Prof. d.m.s. T.V. Tyurina, Chief Physician, Leningrad Regional Clinical Hospital; chief obstetrician-gynecologist of the Leningrad region Khantalina G.M .; head Department of reproductive health of women prof. d.m.s. Safronova M.M .; prof. d.m.s. Savicheva A.M., Head of the Laboratory of Microbiology, D.O. Ott Research Institute of Obstetrics and Gynecology, V.A., Ph.D., Head of the Department of Clinical Laboratory Diagnostics.

Reports of the first part of the conference

Tamazyan N.V., Vorobiev S.L., Ph.D., Head. by the cytological laboratory of the National Center for Clinical Morphological Diagnostics, St. Petersburg.
The role of a cytologist in the management of patients with inflammatory diseases of the cervix, reports NV Tamazyan, 20 min.
Kotov V.A., Candidate of Medical Sciences, Associate Professor of the Department of Pathological Anatomy, North-Western State Medical University named afterMechnikova, Head of the Department of Clinical Laboratory Diagnostics No. 2, GKUZ LO PAB, St. Petersburg.
New cytological classification of cervical pathology “The Bethesda System 2014” and its practical application, 20 min.
Safronova M.M., doctor of medical sciences, prof., Head. Department of Reproductive Health of Women, North-Western State Medical University named after Mechnikov, St. Petersburg.
Sexually transmitted infections: diagnosis and treatment, 20 min.
Melnikov O. L., Doctor of Medical Sciences, Associate Professor of the Department of Obstetrics and Gynecology, State North-Western Medical University named after Mechnikov
Philosophy of vaginal dysbiosis, 20 min.
Savicheva A.M., Doctor of Medical Sciences, Professor, Head of the Laboratory of Microbiology, D.O. Ott Research Institute of Obstetrics and Gynecology, St. Petersburg.
Vaginal dysbiosis. Modern diagnostic and therapeutic methods, 20 min.
IV Volchek, Ph.D., General Director of DiscoveryMed LLC, Editor-in-Chief of Publishing House Terra Medica, St. Petersburg.
Possibilities of personalized therapy for diseases of the cervix and vulvovaginal tract, 20 min.

Coffee break, 30 min.

Reports of the second part of the conference

Chairs:

Professor of the Department of Obstetrics and Gynecology, DPO “Institute for Advanced Studies” and Head of the Department of Oncology of the Federal Scientific Center of the Federal Medical and Biological Agency, Dr. med. A.G. Kedrova; prof.d.m.s. EB Troik, Department of Women’s Reproductive Health; prof. d.m.s. Shperling N.V., Professor of the Department of Clinical Medicine of the Medical Institute “Reaviz”; Associate Professor Ph.D. T. N. Bebneva, Department of Gynecology and Reproductive Medicine, PFUR; Associate Professor Ph.D. Minkevich K.V., Department of Reproductive Health of Women, N.W. Mechnikova,

Kedrova A.G., Doctor of Medical Sciences, Professor of the Department of Obstetrics and Gynecology, DPO “Institute for Advanced Studies”, Moscow.
Why is HPV persistent ?, 20 min.
Troik E.B., MD, prof. Department of Reproductive Health of Women, North-Western State Medical University named after Mechnikov, St. Petersburg.
Report to be confirmed, 20 min.
Bebneva T.N., Candidate of Medical Sciences, Associate Professor of the Department of Obstetrics, Gynecology and Reproductive Medicine, PFUR, Moscow.
Cervicitis and cervical neoplasia, 20 min.
Letyaeva O.I., Doctor of Medical Sciences, Professor of the Department of Dermatovenereology, South Ural State Medical University, Chelyabinsk
Urogenital infections: diagnostic errors and therapy failures.How to solve the problem? 20 minutes.
Shperling N.V., Doctor of Medical Sciences, Professor of the Department of Clinical Medicine of the Medical Institute “Reaviz”, St. Petersburg.
Cervicitis and HPV, 20 min
Ptushkina L.Yu., doctor of the Department of Gynecology, Leningrad Regional Clinical Hospital
Experience in the use of ultrasonic cavitation in chronic endometritis and cervicitis, 20 min.
Minkevich K.V., Candidate of Medical Sciences, Associate Professor of the Department of Obstetrics and Gynecology, Obstetrics and Gynecology named after S.Davydov State North-Western Medical University named after Mechnikov,
Destructive treatment of the cervix. How to improve the result? 20 minutes.

The conference has ended.

90,000 Management of mild atypia of cervical cells detected by cervical screening

Question
Cervical screening can reduce the risk of cervical cancer through cervical cytology (smear analysis), which is used to detect and further treat various precancerous changes that may increase the risk of invasive diseases (invasive cervical cancer) in the future.Typically, only severe precancerous changes require treatment, but there are differences in treatment for women with minor cytological changes (atypical squamous cells of undetermined origin (ASCUS / borderline changes) or mild epithelial lesion (LSIL / mild dyskaryosis) with impossibility of routine testing for HPV (human papillomavirus).

Objective of the review
We wanted to find out which of the methods – immediate colposcopy or “observational wait” with repeated oncocytological analysis – is the best method for women with mild atypia of cervical cells.

What are the main results?
We included 5 randomized controlled trials in which 11 466 patients with mild atypia of cervical cells who underwent immediate colposcopy or repeated cytological examination took part. The included studies assessed the differences in the incidence of precancerous changes in the cervix between the two procedures.

The results suggest that women referred for immediate colposcopy after detection of mild cervical atypia during a single cytology study are more likely to receive clinically insignificant results than with “watchful waiting”.

There were 18 cases of invasive cervical cancer, seven in the immediate colposcopy group, and 11 in the cytology follow-up groups. The detection rate of clinically insignificant mild lesions was higher in the immediate colposcopy group, as was the detection rate of clinically significant, high-grade precancerous lesions (CIN2 or CIN2 or worse) at 18 months but not 24 months.

The risk of adherence failure was significantly greater in the repeat cytology group and increased with follow-up.

Quality of evidence
We rated the quality of evidence as low to moderate.

What are the conclusions?
HPV DNA testing has proven to be an effective method of screening for mild atypia of cervical cells. However, at present, the routine use of this test worldwide is not possible. Due to the unavailability of HPV DNA testing, immediate colposcopy is likely to help diagnose more precancerous lesions early than cytological observation, but after two years there may be no difference between these approaches.Women may be referred for immediate colposcopy after a single detection of mild atypia or borderline cytological findings if adherence to cytological follow-up is expected to be low. If high adherence is expected, repeated cytological examinations may be offered, as they can reduce the risk of overdiagnosis and redundancy of interventions.