About all

Nystatin ringworm: Symptoms, Treatment, Causes & Pictures

Содержание

Steroid creams can make ringworm worse | Fungal Diseases

Information for healthcare professionals

Some forms of ringworm can be treated with non-prescription (“over-the-counter”) antifungal creams, lotions, or powders. However, other forms of ringworm need treatment with prescription antifungal medicine.

Topical corticosteroid use without an antifungal agent is not recommended for tinea (ringworm) infections. However, patients may have already applied corticosteroids on their own. For example, patients may have applied over-the-counter low-potency topical corticosteroids before seeking medical care. Others may have used higher potency corticosteroids from:

  • A prescription because of misdiagnosis of tinea as another condition.
  • Treatment for an unrelated condition.
  • A previous prescription.
  • Purchase abroad.

Use of topical corticosteroids on tinea can lead to:

  • More or larger tinea lesions.
  • Atypical appearance, called tinea incognito, which may involve less erythema (redness), less scale, and indistinct borders of the lesion. Unusual shapes or patterns can mimic other conditions like atopic dermatitis (eczema). 7,8
  • Majocchi’s granuloma, in which the dermatophytes invade deeper than the epidermis (into the dermis or subcutaneous tissue).9

These conditions resulting from topical corticosteroid use on tinea are sometimes referred to as steroid-modified tinea.1 Use of topical corticosteroids for tinea also has led to thinning of the skin, striae (stretch marks), and pigment changes when applied to sensitive regions or through excessive or high-potency corticosteroid use.10

Combination antifungal and mid-potency corticosteroid creams are available by prescription in the United States. Healthcare providers should be aware that treatment failure has been reported with use of combination therapy for tinea and use of certain formulations is not recommended in children.11,12

An Emerging International Problem in India
Dermatologists in India have reported severe steroid-modified tinea associated with use of over-the-counter mid- to high-potency topical corticosteroids, which are commonly sold as fixed-dose combinations with an antifungal medication and one or two antibacterial medications. 1-6

In India, a dermatophyte species often identified as Trichophyton mentagrophytes has been reported as the cause of these breakthrough infections.13 Genetic sequencing of Trichophyton isolates causing multidrug-restraint tinea in North India suggests that they are highly related and belong to a unique clade indistinguishable from T. mentagrophytes/T. interdigitale.14 More research on this topic is needed.

For recalcitrant tinea infections associated with international travel, consider obtaining culture for species identification. Because the emerging resistant Trichophyton species can be confused with other closely related Trichophyton species, molecular testing may be needed for full species identification. Prolonged courses of higher dose oral antifungals may be needed to treat severe or recurrent infections.

Nystatin; Triamcinolone cream or ointment

What is this medicine?

NYSTATIN; TRIAMCINOLONE (nye STAT in; trye am SIN oh lone) is a combination of an antifungal medicine and a steroid. It is used to treat certain kinds of fungal or yeast infections of the skin.

This medicine may be used for other purposes; ask your health care provider or pharmacist if you have questions.

COMMON BRAND NAME(S): Myco-Triacet-II, Mycogen-II, Mycolog II, Mytrex, N.T.A.

What should I tell my health care provider before I take this medicine?

They need to know if you have any of these conditions:

  • large areas of burned or damaged skin
  • skin wasting or thinning
  • peripheral vascular disease or poor circulation
  • an unusual or allergic reaction to nystatin, triamcinolone, other corticosteroids, other medicines, foods, dyes, or preservatives
  • pregnant or trying to get pregnant
  • breast-feeding

How should I use this medicine?

This medicine is for external use only. Do not take by mouth. Follow the directions on the prescription label. Wash your hands before and after use. If treating hand or nail infections, wash hands before use only. Apply a thin layer of this medicine to the affected area and rub in gently. Do not use on healthy skin or over large areas of skin. Do not get this medicine in your eyes. If you do, rinse out with plenty of cool tap water. When applying to the groin area, apply a limited amount and do not use for longer than 2 weeks unless directed to by your doctor or health care professional. Do not cover or wrap the treated area with an airtight bandage (such as a plastic bandage). Use the full course of treatment prescribed, even if you think the infection is getting better. Use at regular intervals. Do not use your medicine more often than directed. Do not use this medicine for any condition other than the one for which it was prescribed.

Talk to your pediatrician regarding the use of this medicine in children. While this drug may be prescribed for selected conditions, precautions do apply. Children being treated in the diaper area should not wear tight-fitting diapers or plastic pants.

Elderly patients are more likely to have damaged skin through aging, and this may increase side effects. This medicine should only be used for brief periods and infrequently in older patients.

Overdosage: If you think you have taken too much of this medicine contact a poison control center or emergency room at once.

NOTE: This medicine is only for you. Do not share this medicine with others.

What if I miss a dose?

If you miss a dose, use it as soon as you can. If it is almost time for your next dose, use only that dose. Do not use double or extra doses.

What may interact with this medicine?

Interactions are not expected. Do not use any other skin products on the affected area without telling your doctor or health care professional.

This list may not describe all possible interactions. Give your health care provider a list of all the medicines, herbs, non-prescription drugs, or dietary supplements you use. Also tell them if you smoke, drink alcohol, or use illegal drugs. Some items may interact with your medicine.

What should I watch for while using this medicine?

Tell your doctor or health care professional if your symptoms do not start to get better within 1 week when treating the groin area or within 2 weeks when treating the feet. .

Tell your doctor or health care professional if you develop sores or blisters that do not heal properly. If your skin infection returns after stopping this medicine, contact your doctor or health care professional.

If you are using this medicine to treat an infection in the groin area, do not wear underwear that is tight-fitting or made from synthetic fibers such as rayon or nylon. Instead, wear loose-fitting, cotton underwear. Also dry the area completely after bathing.

What side effects may I notice from receiving this medicine?

Side effects that you should report to your doctor or health care professional as soon as possible:

  • burning or itching of the skin
  • dark red spots on the skin
  • loss of feeling on skin
  • painful, red, pus-filled blisters in hair follicles
  • skin infection
  • thinning of the skin or sunburn: more likely if applied to the face

Side effects that usually do not require medical attention (report to your doctor or health care professional if they continue or are bothersome):

  • dry or peeling skin
  • skin irritation

This list may not describe all possible side effects. Call your doctor for medical advice about side effects. You may report side effects to FDA at 1-800-FDA-1088.

Where should I keep my medicine?

Keep out of the reach of children.

Store at room temperature between 15 and 30 degrees C (59 and 86 degrees F). Do not freeze. Throw away any unused medicine after the expiration date.

NOTE: This sheet is a summary. It may not cover all possible information. If you have questions about this medicine, talk to your doctor, pharmacist, or health care provider.

Ringworm, Beard (Tinea Barbae) Condition, Treatments, and Pictures for Teens – Overview

52393
38

Information for
TeenAdult

caption goes here…

Images of Tinea Barbae (Ringworm of Beard)

Overview

Tinea infections are commonly called ringworm, though there is no worm, because the rash, which is caused by a fungus, forms a pattern that resembles a ring with an outer scaly circle. Tinea barbae is an infection that specifically affects the part of the face that is usually shaven, known as the beard distribution. Beard ringworm is contagious and is passed from person to person, animal to person, and from contaminated objects (such as towels and pillows) to person. It would be possible for beard ringworm in one person to be passed as a facial, body, or scalp ringworm in another person because all the infections are caused by the same fungi.

Who’s at risk?

Almost anyone with facial hair can get beard ringworm, though it is most commonly seen in men who shave and in women who have coarse facial or neck hair. It also tends to occur more often in people who live in warm, humid climates and people who work with farm animals. Beard ringworm is more commonly seen in warmer, more humid climates. It is most frequently passed to humans from animals, so agricultural workers are the most commonly infected people with beard ringworm.

Signs and Symptoms

The most common locations for beard ringworm infection include the following:

  • Chin
  • Cheeks
  • Neck
  • Upper lip

Beard ringworm may affect either the outer surface (superficial) or the deep portion of the skin that holds shafts of hair (hair follicles). If the infection is superficial, beard ringworm appears as a pink-to-red scaly patch ranging in size from 1 to 5 cm. Alternatively, small pus-filled bumps (pustules) may be seen around hair follicles in the affected skin. In deeper forms of beard ringworm, you may see firm red nodules covered with pustules or scabs that may ooze blood and pus.

Beard ringworm is usually itchy. Deeper forms of beard ringworm may be accompanied by fever and swollen lymph glands.

Self-Care Guidelines

It is extremely difficult to totally get rid of beard ringworm with only topical medications; oral antifungal medications are usually required. However, if the infection has just started, you might try one of the following over-the-counter antifungal creams or lotions:

  • Terbinafine
  • Clotrimazole
  • Miconazole

Apply the cream to each lesion and to the normal-appearing skin 2 cm beyond the border of the affected skin for at least 2 weeks until the areas are completely clear of lesions. Remember, you will probably not be able to totally get rid of the beard ringworm with topical creams.

Stop shaving the affected area until you start treatment. If you must shave, use a new disposable razor each time you shave.

Since people often have tinea infections on more than one body part, examine yourself for other ringworm infections, such as in the groin (tinea cruris), on the feet (tinea pedis, athlete’s foot), and anywhere else on the body (tinea corporis).

Have any household pets or farm animals evaluated by a veterinarian to make sure they do not have a fungal (ie, dermatophyte) infection. If the veterinarian discovers an infection, be sure to have the animal treated.

When to Seek Medical Care

If the lesions do not improve after 1 or 2 weeks of applying over-the-counter antifungal creams, see your doctor for an evaluation. If the affected areas are deep and tender or if you have a fever or swollen lymph glands, see your doctor as soon as possible.

Treatments Your Physician May Prescribe

To confirm the diagnosis of beard ringworm, your physician might scrape some surface skin material (scales) or pluck an affected hair and place it onto a glass slide for examination under a microscope. This procedure, called a KOH (potassium hydroxide) preparation, allows the doctor to look for tell-tale signs of fungal infection.

If you have many pus-filled lesions or if deeper lumps are present, your physician may wish to perform a procedure to grow out the fungus (fungal culture) in order to discover the particular organism that may be causing the infection. The procedure involves:

  1. Penetrating the pus-filled lesion with a needle, scalpel, or lancet.
  2. Rubbing a sterile cotton-tipped applicator across the skin to collect the pus.
  3. Sending the specimen away to a laboratory.

The fungal culture can take up to 3 weeks to produce final results.

Since beard ringworm usually requires oral antifungal pills in order to get rid of the infection completely, your physician will likely recommend one of the following oral medications:

  • Terbinafine
  • Itraconazole
  • Griseofulvin
  • Fluconazole
  • Ketoconazole

Beard ringworm should go away within 4–6 weeks after using effective treatment.

Trusted Links

Clinical Information and Differential Diagnosis of Tinea Barbae (Ringworm of Beard)

References

Bolognia, Jean L., ed. Dermatology, pp.1174-1185. New York: Mosby, 2003.

Freedberg, Irwin M., ed. Fitzpatrick’s Dermatology in General Medicine. 6th ed. pp.1861, 1996-1997. New York: McGraw-Hill, 2003.

Fungal skin infections – MyDr.com.au

General Information

Areas commonly affected by fungal infections include the skin, scalp, feet, fingernails and toenails, mouth and vagina. Fungi need a warm, wet place to grow and they thrive on hot, sweaty skin, especially between your toes, in your groin and under your armpits.

There are two common types of fungal skin infection; tinea and candida.

Tinea infections are known as ringworm when found on your trunk, limbs or scalp. Tinea is known as athlete’s foot when your feet are affected, or jock itch when your groin area is affected. Thrush is the name for candida infections in the mouth, vagina or nappy area in babies. It can also occur under breasts, armpits or in your groin.

Fungal infections can spread from person to person via bathroom or shower floors, towels or clothing, or from animals or soil to people. Public swimming pools are a common place to contract a fungal foot infection.

Athlete’s foot

Athlete’s foot is also known as tinea pedis. It is a fungal infection of the skin between your toes, which can spread further on your foot if left untreated. It appears as a patch of soft, white, cracked skin, sometimes with red areas visible beneath. Athlete’s foot may cause itching, burning or stinging and can create an unpleasant odour. The infection can spread to the nails causing the nail to change colour and become thick. It spreads via wet floors and shared footwear or towels.

Fungal nail infections

Fungal nail infections (also called tinea unguium or onychomycosis) are often caused by the spread of athlete’s foot but can occur on their own. The nail looks thick and discoloured (white or yellowish). The nail may be brittle or crumbly and parts, or all of it, may fall off. Toenails are affected more than fingernails. Often the infection is really only a problem in terms of how it looks, but can become a problem if it causes pain or a risk of infection develops.

Jock itch

With jock itch (also known as tinea cruris) the groin and inner thigh become red and itchy. It is more common in men than women, and often occurs if you also have athlete’s foot, since the infection can be spread from foot to groin. You are more likely to develop jock itch if you sweat a lot, are overweight, have diabetes or a weak immune system.

Ringworm

Ringworm is also known as tinea corporis. It is not caused by a worm but has this name because it can look like there is a worm under the skin. Patches of ringworm are circular, red and itchy. They have a raised edge and an area of clear skin in the middle.

Thrush (vaginal thrush, oral thrush and nappy rash)

Thrush is also known as candidiasis (infection with candida).

Symptoms of vaginal thrush include itching, irritation or a burning sensation in your genital area. There may be a thick, white or creamy vaginal discharge which has no odour. The risk of vaginal thrush is increased by taking oral contraceptives, pregnancy, taking antibiotics, spending prolonged time in damp clothes including swimmers and workout wear, and diabetes.

Oral thrush causes your mouth to be sore and look red. There may be white patches visible on your tongue and inside your cheeks. If the white patches are scraped away the skin underneath will be red and sore. You may experience a ‘cottony’ feeling in your mouth and a lack of taste. Eating and drinking can be uncomfortable. It is more common in babies, people who wear dentures, and people with diabetes or with asthma who use steroid inhalers. It can also affect those who have conditions affecting their immune system, and can occur after a course of antibiotics.

Sometimes nappy rash can be due to a thrush infection. When this happens, the area looks bright red and shiny and there may be white spots. The rash may spread into the creases of the baby’s groin.

See Your Pharmacist or Medical Professional

  • if the infection is in your mouth, vagina, nails, scalp or beard
  • if you have blistered, broken or raw skin
  • if the itching is very severe
  • if you have had repeated infections or the area affected is large
  • if you have been treated for a fungal infection and it has not worked
  • if the infection started in a baby’s nappy area but has spread, or the baby has other symptoms (e.g. fever)

Treatment Tips

Athlete’s foot and nail infections

  • bleach the shower and bath areas to prevent spreading and reinfection
  • wash your socks and towels in hot water
  • wear thongs in communal changing areas to prevent spreading the infection
  • if you have sweaty feet, use an antiperspirant, or foot powders and sprays, such as Thursday Plantation Tea Tree Foot Spray, to help prevent athlete’s foot developing

Jock itch and ringworm

  • keep the area of skin dry
  • avoid sharing towels, bedding and clothing and wash them frequently
  • if you have ringworm, have any pets checked for signs of infection

Treatment Options

Antiperspirants

[GENERAL SALE]
e. g. aluminium chlorohydrate (Neat Feet Roll On Deodorant, 3B Action Cream )

  • as prevention, antiperspirants are used to reduce sweating, which makes the skin drier and less likely to grow fungi
  • 3B Action Cream can be applied to the buttocks, between the legs or under the breasts.

Topical antifungals for tinea (athlete’s foot, jock itch, ringworm)

[GENERAL SALE]
e.g. undecanoate and chloroxylenol (Gordochom Solution), tolnaftate (Tinaderm Power Spray for Tinea), terbinafine (SolvEasy Tinea Cream for Athlete’s Foot, SolvEasy Tinea Spray, Lamisil Once Solution), Excilor Protector Spray, melaleuca oil (Thursday Plantation Tea-Tree Antifungal Gel)

[PHARMACY ONLY]
e.g. bifonazole (Canesten Once Daily Bifonazole Cream 1%, Mycospor), clotrimazole (Canesten Clotrimazole, Clonea),

econazole (Pevaryl Antifungal Cream, Pevaryl Foaming Solution),

ketoconazole (DaktaGOLD, Nizoral Cream),

miconazole (Daktarin, Resolve range, Eulactol Spray), terbinafine (Lamisil range, SolvEasy Tinea Cream, Chemists’ Own Tamsil, Pharmacy Action Pharmisil, Tinasil)

  • topical antifungals are available as creams, gels, liquids, spray powders and powders; ask your pharmacist which product is most suitable
  • most antifungal products stop the growth of fungi but do not kill them
  • continue treatment for at least 14 days after the area has healed because the body needs to shed the infected skin for complete eradication of the fungi
  • products such as terbinafine do kill the fungi, meaning treatment courses are shorter
  • athlete’s foot can be treated with terbinafine for just one week, in most cases
  • there are also products available which combine an antifungal agent with hydrocortisone (steroid) cream [Pharmacist Only products], such as Resolve Plus (miconazole + hydrocortisone) and Hydrozole and Canesten Extra and Canesten Plus (clotrimazole + hydrocortisone)
  • these combination treatments can be useful if there is severe itching
  • these combination products should be used for a maximum of 7 days, then a product containing an antifungal alone should be used for the rest of the treatment
  • foot powders, such as Dermal Therapy Foot Odour Control Powder Spray, Odor-Eaters Foot Powder, can be used to prevent athlete’s foot from recurring; sprinkle into socks and shoes each day
  • it’s a good idea to treat your footwear with antifungal medicine as well to avoid reinfecting yourself. You can place gauze or cotton between your toes if there are small blisters or the skin feels soggy. If appropriate, you may with to wear ‘open’ footwear as much as possible, to allow your feet to ‘breathe’.

Treatments for thrush infections of the skin

  • for thrush infections of the skin, the same treatments may be used as for tinea infections but terbinafine is less effective for thrush
  • nystatin (Mycostatin Topical (cream), Pharmacy Action Nystatin [Pharmacy Only] is also effective
  • nystatin should be applied twice a day and be continued for 14 days after the area has healed
  • nystatin may stain clothing
  • if the thrush infection is vaginal, talk to your pharmacist; there are other specific products available to treat this

Treatments for thrush infections of the mouth

[PHARMACIST ONLY]
e.g. miconazole (Daktarin Oral Gel), nystatin (Mycostatin Oral Drops, Nilstat Oral Drops)

  • it is best to use these oral drops and gels after your meals and drinks to prevent the medicine from being rinsed away
  • these should be swirled around the mouth for as long as possible then swallowed
  • continue treatment for 2 days after symptoms have cleared to ensure the infection is completely gone.

More Information

Availability of medicines

  • GENERAL SALE available through pharmacies and possibly other retail outlets.
  • PHARMACY ONLY available for sale through pharmacies only.
  • PHARMACIST ONLY may only be sold by a pharmacist.

Search myDr for Consumer Medicine Information

1. Adam O Goldstein, M. M. (2019, August 30). Dermatophyte (tinea) infections. (Wolters Kluwer) Retrieved September 3, 2019, from UpToDate: https://www-uptodate-com.libraryproxy.griffith.edu.au/contents/dermatophyte-tinea-infections?search=tinea&source=search_result&selectedTitle=1~150&usage_type=default&display_rank=1#h2
2. AusDI. (2019). CANESTEN® PLUS CLOTRIMAZOLE AND HYDROCORTISONE CREAM. (MedicalDirector) Retrieved September 3, 2019, from AusDI: https://ausdi-hcn-com-au.libraryproxy.griffith.edu.au/quickSearch.hcn
3. AusDI. (2019). NILSTAT® ORAL DROPS. (MedicalDirector) Retrieved September 3, 2019, from AusDI: https://ausdi-hcn-com-au. libraryproxy.griffith.edu.au/productInformation.hcn?file=p02062#d132868e157
4. Carol A Kauffman, M. (2019, May 31). Overview of Candida infections. (Wolters Kluwer) Retrieved September 3, 2019, from UpToDate: https://www-uptodate-com.libraryproxy.griffith.edu.au/contents/overview-of-candida-infections?search=candida&source=search_result&selectedTitle=1~150&usage_type=default&display_rank=1#H5
5. Therapeutic Guidelines Ltd. (2019, June). Onychomycosis (tinea of the nails). Retrieved September 3, 2019, from Therapeutic Guidelines: https://tgldcdp-tg-org-au.libraryproxy.griffith.edu.au/etgAccess
6. Therapeutic Guidelines Ltd. (2019, April). Oral candidosis. Retrieved September 3, 2019, from Therapeutic Guidelines: https://tgldcdp-tg-org-au.libraryproxy.griffith.edu.au/etgAccess
7. Therapeutic Guidelines Ltd. (2019, April). Tinea. Retrieved September 3, 2019, from Therapeutic Guidelines: https://tgldcdp-tg-org-au.libraryproxy.griffith.edu.au/etgAccess

Nyaderm – Uses, Side Effects, Interactions

How does this medication work? What will it do for me?

Nystatin belongs to the group of medications known as antifungals. Nystatin oral medications in liquid form are most often used to treat fungal infections in the mouth.

The liquid and tablets are used to treat a fungal infection of the intestine known as candidiasis. This occurs when the fungus known as Candida albicans overgrows in the intestine as a result of antibiotic or corticosteroid use. The medication may also be used to prevent fungal infections.

The powder can be used to make an oral liquid or added to creams or ointments. The skin cream and ointment are used to treat fungal skin infections. The vaginal cream and vaginal tablets are used to treat vaginal infections caused by Candida albicans.

Your doctor may have suggested this medication for conditions other than those listed in these drug information articles. As well, some forms of this medication may not be used for all of the conditions discussed here. If you have not discussed this with your doctor or are not sure why you are taking this medication, speak to your doctor. Do not stop taking this medication without consulting your doctor.

Do not give this medication to anyone else, even if they have the same symptoms as you do. It can be harmful for people to take this medication if their doctor has not prescribed it.

What form(s) does this medication come in?

Topical Cream

Each g of aqueous, perfumed vanishing cream base contains nystatin USP 100,000 units. Nonmedicinal ingredients: aluminum hydroxide gel, ceteareth-15, glyceryl monostearate, methylparaben, perfume 9128-Y, polyethylene glycol-400 monostearate, propylene glycol, propylparaben, purified water, simethicone emulsion, sodium hydroxide, sorbitol solution, titanium dioxide, and white petrolatum.

Vaginal Cream

Each g contains nystatin USP 25,000 units. Nonmedicinal ingredients: aluminum hydroxide gel, methylparaben, promulgen-D, propylene glycol, propylparaben, purified water, simethicone emulsion, and white petrolatum. Sodium hydroxide and hydrochloric acid to adjust the pH.

How should I use this medication?

Oral suspension (ready-made liquid or powder mixed with liquid): The recommended dose of nystatin oral suspension for prevention or treatment of candida infections in infants and children with mouth or intestinal infections is 100,000 units (1 mL of suspension) 3 or 4 times daily, dropped onto the tongue and then swallowed. In some cases the solution should be held in the mouth for some time and gargled before swallowing.

For young infants and children, the solution may be mixed with milk, lukewarm formula, jam, or peanut butter. For adults, the usual dose is 400,000 to 600,000 units 4 times daily. Shake the bottle before use. Use an oral syringe to measure each dose of the liquid, as it gives a more accurate measurement than household teaspoons.

Oral tablets: The usual dose is one tablet (500,000 units) 3 times daily. In adults, this dosage can be increased to 2 tablets 3 times daily if necessary.

Skin cream or ointment: Apply cream or ointment liberally to affected areas twice daily or as prescribed by your doctor. Severe fungal infections may require the use of both oral and topical nystatin.

Vaginal cream: The usual dose is one full applicator (5 grams) inserted into the vagina daily. In severe infections, a dose of one applicator every 12 hours may be given. Usually, treatment is given for 2 weeks. Treatment should be continued during menstruation.

Vaginal tablets: The usual dose is one tablet inserted high into the vagina using the applicator, once or twice daily. Usually, treatment is given for 2 weeks. Treatment should be continued during menstruation.

To prevent a relapse, treatment should be continued for at least 48 hours after the symptoms go away, regardless of dosage form.

Many things can affect the dose of medication that a person needs, such as body weight, other medical conditions, and other medications. If your doctor has recommended a dose different from the ones listed here, do not change the way that you are taking the medication without consulting your doctor.

It is important to take this medication exactly as prescribed by your doctor. If you miss a dose, take it as soon as possible and continue with your regular schedule. If it is almost time for your next dose, skip the missed dose and continue with your regular dosing schedule. Do not take a double dose to make up for a missed one. If you are not sure what to do after missing a dose, contact your doctor or pharmacist for advice.

Store this medication as directed by your doctor or pharmacist and keep it out of the reach of children.

This medication is available under multiple brand names and/or in several different forms. Any specific brand name of this medication may not be available in all of the forms listed here. The forms available for the specific brand you have searched are listed under “What form(s) does this medication come in?”

Do not dispose of medications in wastewater (e.g. down the sink or in the toilet) or in household garbage. Ask your pharmacist how to dispose of medications that are no longer needed or have expired.

Who should NOT take this medication?

Do not use this medication if you are allergic to nystatin or any ingredients of the medication.

What side effects are possible with this medication?

Many medications can cause side effects. A side effect is an unwanted response to a medication when it is taken in normal doses. Side effects can be mild or severe, temporary or permanent.

The side effects listed below are not experienced by everyone who takes this medication. If you are concerned about side effects, discuss the risks and benefits of this medication with your doctor.

The following side effects have been reported by at least 1% of people taking this medication. Many of these side effects can be managed, and some may go away on their own over time.

Contact your doctor if you experience these side effects and they are severe or bothersome. Your pharmacist may be able to advise you on managing side effects.

  • diarrhea
  • nausea or vomiting
  • rash
  • stomach pain
  • vaginal or skin irritation

Stop taking the medication and seek immediate medical attention if any of the following occur:

  • difficulty breathing
  • hives
  • muscle pain
  • rapid heart rate
  • Stevens-Johnson syndrome (severe skin rash with blistering and sloughing off of the skin)
  • swelling of the face

Some people may experience side effects other than those listed. Check with your doctor if you notice any symptom that worries you while you are taking this medication.

Are there any other precautions or warnings for this medication?

Before you begin using a medication, be sure to inform your doctor of any medical conditions or allergies you may have, any medications you are taking, whether you are pregnant or breast-feeding, and any other significant facts about your health. These factors may affect how you should use this medication.

Diabetes: Nystatin suspension contains significant amounts of sucrose. If you have diabetes, discuss with your doctor how this medication may affect your medical condition, how your medical condition may affect the dosing and effectiveness of this medication, and whether any special monitoring is needed.

Pregnancy: The safety of nystatin for use during pregnancy has not been established. This medication should not be used during pregnancy unless the benefits outweigh the risks. If you become pregnant while using this medication, contact your doctor immediately.

Breast-feeding: It is not known if nystatin passes into breast milk. If you are a breast-feeding mother and are taking this medication, it may affect your baby. Talk to your doctor about whether you should continue breast-feeding.

What other drugs could interact with this medication?

Tell your doctor or prescriber about all prescription, over-the-counter (non-prescription), and herbal medications that you are taking. Also tell them about any supplements you take. Since caffeine, alcohol, the nicotine from cigarettes, or street drugs can affect the action of many medications, you should let your prescriber know if you use them. Depending on your specific circumstances, your doctor may want you to:

  • stop taking one of the medications,
  • change one of the medications to another,
  • change how you are taking one or both of the medications, or
  • leave everything as is.

An interaction between two medications does not always mean that you must stop taking one of them. Speak to your doctor about how any drug interactions are being managed or should be managed.

All material copyright MediResource Inc. 1996 – 2021. Terms and conditions of use. The contents herein are for informational purposes only. Always seek the advice of your physician or other qualified health provider with any questions you may have regarding a medical condition. Source: www. medbroadcast.com/drug/getdrug/Nyaderm

Skin Infestations: Fungal and Scabies | 2018-04-03 | AHC Media – Continuing Medical Education Publishing | Relias Media

Most of us will hardly flinch if we hear “Cardiac arrest coming in,” but will recoil in terror at “How are you at rashes?” I am not a dermatologist and don’t want to be. But there is hardly a day that goes by that I am not asked by someone (a patient, a colleague, a friend, or a family member) to look at a rash or lesion on the skin. While some patients present for their rash primarily, many will “add it on” to the visit. In many emergency departments (EDs), a dermatology, or even primary care, follow-up visit is not an option. Therefore, emergency providers need a working understanding of common rashes, and also should recognize those rashes that need referral.

This article provides an in-depth look at common rashes caused by fungi and scabies. We have included some information about potassium hydroxide (KOH) staining, which long has been the standard for making the diagnosis of tinea. I recognize that many no longer have a microscope available in the ED, and many ED providers may not even know how to use one. That information is included for the few of you who can use it.

Although cutaneous fungal infections rarely are life-threatening, they are common, and they are irritating. This review should help you diagnose and treat these infections.

Sandra M. Schneider, MD, Editor

Introduction

Tinea refers to a superficial fungal infection of the skin, hair, and nails caused by dermatophytes. Dermatophytes are filamentous fungi; the three genera that cause disease are Microsporum, Trichophyton, and Epidermophyton.1Trichophyton rubrum is the most common cause of dermatophyte infection, accounting for nearly 70% of infections worldwide.1 These infections are extremely common, but are more prominent in warm, tropical climates. Tinea is seen more commonly in black and Asian patients, has a predilection for young adults, and is three to four times more common in males. 1 Dermatophyte infections are alike in their physiology, morphology, and pathogenicity and are referred to clinically as “tinea.”

Transmission may be anthropophilic (human to human), zoophilic (animal to human), or geophilic (soil to human/animal).1 Unlike other fungi, dermatophytes metabolize keratin as an energy source. They are not particularly virulent and typically invade only the cornified, outer layers of the epidermis. Mannans in the dermatophyte cell wall contribute to invasion of the skin by decreasing epidermal proliferation and by exhibiting immune-inhibitory effects.1 Defects in the skin barrier (diseases such as Darier disease, Hailey-Hailey disease, and ichthyosis) or maceration tend to encourage dermatophyte invasion.1 Protective host factors that limit invasion to the keratinized tissue include protease inhibitors, sebum, serum factors, and the host immune system.1 Immunodeficient hosts (chronic mucocutaneous candidiasis, common variable immunodeficiency, and HIV) tend to have more severe, chronic, or recurrent infections than immunocompetent hosts.

Dermatophyte infections commonly are misdiagnosed in clinical practice. The clinical appearance of these infections can vary, and many other dermatologic diseases may have a similar appearance. This review will help you diagnose and treat your patients and provide the most current treatment regimens.

Subtypes of Tinea Infections

Clinical dermatophyte infections tend to be named for the involved body area. The clinical subtypes include tinea corporis (body), tinea capitis (scalp), tinea cruris (groin), tinea pedis (feet), tinea manuum (hands), tinea unguium (nails), tinea barbae (beard), and tinea faciei (face). See Figure 1 for a clinical presentation of tinea manuum. See Table 1 for the clinical features of tinea and its mimickers.

Small collarettes of scale are typical of superficial fungal infections located on the palms and soles.

Image courtesy of Jessica Perkins, DO.

Tinea Corporis

Annular plaques with a central clearing and a leading edge of scale

Nummular Eczema

Nummular or “coin-shaped” erythematous, scaly plaques in typical distributions (antecubital and popliteal fossa, posterior neck, lower extremities), atopic diathesis

Erythema Annulare Centrifugum

Annular erythema with a trailing scale; may be a response to a tinea infection; perform full skin exam

Scabies

Erythematous papules to pustules with excoriations and possible burrows, flexor wrists, interdigital webspaces, umbilicus, genitals

Lichen Planus

Purple, polygonal, flat-topped papules ± lacy reticulated scale; flexor wrists, ankles, trunk ± oral lesions

Psoriasis Vulgaris

Elevated, well-demarcated, erythematous plaques with overlying silvery scale

Seborrheic Dermatitis

Waxy, yellow scale on an erythematous base; scalp, central face, eyebrows, beard, central chest

Pustular Psoriasis

Deep, yellow papules ± brown collarettes of scale on the plantar/palmar surfaces

Subacute Cutaneous Lupus Erythematosus

Annular, erythematous plaques with central clearing in a photodistribution (V-neck and upper back ± upper arms)

Pityriasis Rosea

Single patch (herald patch) followed by eruption of flesh to erythematous colored scaly patches in a “Christmas tree” distribution on the trunk

Source: Author created.

Tinea Corporis

Tinea corporis is an infection of the body surfaces other than palms/soles, groin, face, scalp, hair, and nails. It usually occurs on exposed skin of the trunk and extremities and generally is confined to the epidermis. It is usually acquired by direct contact or secondarily spread from another infected body area.1 The most common pathogen is T. rubrum, followed by T. mentagrophytes.1 Infection with T. tonsurans may occur in adults from contact with a child with tinea capitis.2 Direct contact with an infected cat or dog may lead to infection with Microsporum canis.2 This infection is found globally; however, it is more common in tropical regions. The classic presentation is referred to as “ringworm” and is characterized by a pruritic, erythematous, scaly patch with a raised border and central clearing.3

Clinical Variants of Tinea Corporis

Majocchi’s granuloma is a rare, deep infection of the hair follicle that invades the dermis or subcutaneous tissue. 2 Inciting events include shaving legs, trauma to skin, or immunosuppression. It is characterized by perifollicular papulopustules or granulomatous nodules.1 Tinea profunda results from excessive inflammation in response to a dermatophyte infection. It may have a granulomatous or verrucous appearance and can be mistaken for cutaneous tuberculosis or squamous cell carcinoma.1

Tinea imbricata (Tokelau ringworm) is a chronic infection caused by T. concentricum and is characterized by concentric annular, scaly, erythematous plaques.1 It occurs in the equatorial regions of the world.

Mimickers of Tinea Corporis

The following conditions can mimic tinea corporis: dermatitis (including nummular eczema, stasis, atopic, contact, and seborrheic dermatitis), pityriasis versicolor, pityriasis rosea, parapsoriasis, erythema annulare centrifugum, elastosis perforans serpiginosa, annular psoriasis, granuloma annulare, subacute lupus erythematosus, mycosis fungoides, and impetigo. 1

Tinea Capitis

Tinea capitis is a dermatophyte infection of the scalp hair that primarily affects children. The peak age is 3 to 7 years, and it is more common in boys.3T. tonsurans accounts for more than 90% of tinea capitis in the United States, with M. canis following as the second most frequent cause.1 Other etiologies include T. violaceum (endemic in Africa) and M. audouinii (Europe).1 Tinea capitis can have a range of clinical presentations that depend on the causative organism as well as the host’s immune response. Alopecia with or without scale is the most common presentation; however, it can vary from mild scaling to a severe pustular eruption with alopecia called a kerion.1

The three patterns of invasion for dermatophytes that infect the hair include endothrix, ectothrix, and favus. Endothrix patterns result from anthropophilic Trichophyton infection within the hair shaft, and common causes include T. tonsurans and T. violaceum.1 Ectothrix patterns occur when the infection is outside the hair shaft and results in destruction of the cuticle. The presentation varies from non-inflamed, scaly, patchy alopecia to kerion formation. Microsporum infections may fluoresce under Wood’s lamp. The favus pattern is caused by T. schoenleinii and is the most severe. It presents as thick, yellow crusts and has a bluish fluorescence under a Wood’s lamp.1 Scarring alopecia may develop if the infection is chronic. It is important to note that many scalp/hair conditions can cause scaling or alopecia, and it is very important to consider and rule out a fungal infection.

Mimickers of Tinea Capitis

Seborrheic dermatitis, alopecia areata, psoriasis, and trichotillomania can mimic tinea capitis. If pustules are present, pyoderma gangrenosum and folliculitis can resemble tinea capitis.1 If scarring is present, lichen planus, discoid lupus erythematosus, and central centrifugal cicatricial alopecia should be part of the differential diagnosis. 1

Tinea Cruris

Commonly known as jock itch, tinea cruris is a dermatophyte infection of the inguinal area. Usually it is seen on the inner aspect of the upper thighs and crural folds, but may be seen in the gluteal cleft and buttocks as well. The three most common pathogens are T. rubrum, E. floccosum, and T. mentagrophytes.1 It is more common in men because the scrotum provides an ideal environment and because more often men have concomitant tinea pedis, which can be transferred to the groin by pulling on undergarments over the feet.1 Characteristically, lesions are sharply demarcated with a raised, erythematous, scaly advancing border. Lesions may have vesicles, and may be unilateral or bilateral. In males, the scrotum usually is spared. Providers should consider cutaneous candidiasis if the scrotum is involved.1

Mimickers of Tinea Cruris

The following conditions can mimic tinea cruris: inverse psoriasis, erythrasma, seborrheic dermatitis, candidal intertrigo, contact dermatitis, lichen simplex chronicus, parapsoriasis, Hailey-Hailey disease, and Langerhans cell histiocytosis. 1

Tinea Pedis

Also known as athlete’s foot, tinea pedis is the most common location for dermatophyte infection. Infection typically occurs on the soles of the feet and, most commonly, in the interdigital area. The major types of tinea pedis are interdigital, hyperkeratotic (moccasin-type), vesiculobullous (inflammatory), and ulcerative. The characteristic finding in the interdigital type is pruritic, erythematous scales and/or erosions that usually present in between the third and fourth toes. Moccasin-type tinea pedis presents as a diffuse, erythematous, hyperkeratotic lesion that covers the soles plus the medial and lateral edges of the feet. (See Figure 2.) The vesiculobullous type presents as an erythematous vesicular or bullous eruption that may be pruritic or painful, and it is most common on the medial aspect of the foot. Similar to tinea cruris, the most common pathogens responsible are T. rubrum, E. floccosum, and T. mentagrophytes. 1 Patients also may have a secondary bacterial infection if they present with malodorous erosions or ulcerations.

Shows the classic appearance of tinea pedis with small collarettes of scale extending past the mid-lateral foot with a minor erythema noted on the base. Tinea unguium also is noted, making this a straightforward clinical case.

Image courtesy of Jessica Perkins, DO.

Tinea manuum has a characteristic presentation of unilateral hyperkeratotic lesions on the palms and interdigital spaces.1,4 The most common pathogens are the same as for tinea pedis and tinea cruris, and these infections often occur concomitantly.

Mimickers of Tinea Pedis

Mimickers of tinea pedis include dermatitis (dishydrotic and contact), psoriasis vulgaris or pustular psoriasis, secondary syphilis, pitted keratolysis, hereditary keratosis palmoplantaris, and juvenile plantar dermatosis.1,3 Erythrasma or bacterial infection may resemble the interdigital type of tinea pedis.1

Tinea Unguium

Tinea unguium is a dermatophyte infection of the nail unit, most commonly caused by T. rubrum, T. mentagrophytes, and E. floccosum.1 Often, this infection is referred to as onychomycosis, an umbrella term that encompasses all fungal infections of the nails including non-dermatophyte causes. However, dermatophytes account for approximately 90% of onychomycosis cases. Tinea unguium is more common in men, is often associated with chronic tinea pedis, and occurs on the toenails more than the fingernails. It may be unilateral or bilateral and may affect only one nail or multiple nails. There are three common patterns that are based on the point of entry for the infection. The distal/lateral subungual type is the most common and presents with onycholysis, yellowing, and thickening of the nails.1 (See Figure 3.) The superficial white type is confined to the dorsal surface of the nail, and presents as white patches (T. mentagrophytes) or transverse striate bands (T. rubrum).1 The proximal subungual type invades underneath the proximal nail fold and usually is found in immunocompromised patients.1

Distal yellow debris on the middle fingernail can serve as a clue to tinea unguium. It is prudent to check the feet in any nail infection, as tinea manuum and pedis are commonly present.

Image courtesy of Jessica Perkins, DO.

Mimickers of Tinea Unguium

Numerous pathogens (dermatophyte and non-dermatophyte) cause onychomycosis, and many factors may cause dystrophy of the nails, making accurate diagnosis a challenge. Diagnoses that can mimic tinea unguium are Candida infections, the nail manifestations of psoriasis, lichen planus, dermatitis, hyperthyroidism, external trauma, pachyonychia, and Darier disease.1 Tinea unguium can be difficult to treat because of the required prolonged treatment times, medication side effects, and recurrences.

Tinea Faciei

A dermatophyte infection on the skin of the face, tinea faciei usually is caused by the same organisms as tinea corporis.4 Infections with T. rubrum can be especially difficult to diagnose, as the margins of the lesion are often indistinguishable. Tinea faciei is seen more frequently in AIDS patients.

Mimickers of Tinea Faciei

Seborrheic, perioral, or contact dermatitis can mimic tinea faciei. Other mimickers include rosacea, lupus erythematosus, acne, and annular psoriasis in children.1

Tinea Barbae

Tinea barbae occurs exclusively in the beard hair distribution of the face and neck of men. It is commonly transmitted by animals, and the typical causative pathogens are T. mentagrophytes and T. verrucosum.1 The clinical presentation may be severe in the zoophilic pathogens, and often it presents with intense inflammation, pustules, and abscesses with bacterial superinfection.4T. rubrum causes a mild, superficial variant similar to tinea corporis.

Mimickers of Tinea Barbae

Bacterial folliculitis, herpes simplex/zoster, acne vulgaris, and cervicofacial actinomycosis can mimic tinea barbae.1

Diagnosis

The most important factor in the diagnosis of a dermatophyte infection is a thorough physical exam. It is important to remember that there may be more than one area of the body infected at the same time, which warrants a complete cutaneous exam. For example, tinea pedis often occurs with tinea unguium or tinea cruris.2

Clinical findings suspicious for a dermatophyte infection should be followed by confirmation testing. Diagnosis usually is confirmed with a potassium hydroxide (KOH) examination via microscopy. Most EDs have removed the microscopes and reagents. For those who still have access to these useful tests, a KOH prep can be very helpful. KOH examinations may be enhanced with chlorazol black E stain. The disadvantage of KOH testing is that it often yields false-negative results.5 A skin scraping for a KOH examination should be taken from the active edge of the lesion with a No. 15 blade.6 The provider should apply alcohol to the lesion before scraping to enhance the scale adhering to the blade.

All dermatophytes appear the same in KOH examinations. If there is a need to identify a particular species, a culture is required. Cultures are slow growing and need many weeks of incubation time.7 If KOH examination and fungal cultures are negative and a dermatophyte infection is still suspected, a skin biopsy may be performed. Although, in general, fungal cultures and skin biopsies are well outside of the emergency physician’s normal practice, many insurance companies require a positive culture before they will cover the treatment. As the cost of some of the drugs may be in the hundreds of dollars, patients may prefer referral to a dermatologist if an expensive or long-term treatment is anticipated (onychomycosis). Skin biopsies will show fungal hyphae within the stratum corneum. Periodic acid-Schiff (PAS) stains and silver stains often are used to enhance fungal elements in biopsy specimens. Techniques using polymerase chain reaction (PCR) and mass spectroscopy also can be used to identify dermatophyte strains.8 PCR is a fast, simple procedure that is highly specific for diagnosis of dermatophyte infections.9 There are also promising studies for immunochromatographic diagnosis of dermatophytes.10 The most reliable way to diagnose onychomycosis is by histologic examination of a formalin-fixed, PAS-stained nail plate.1 The practitioner places a nail clipping into formalin and sends it to the local pathology lab for review.

Treatment

First-line treatment for uncomplicated, superficial, and localized tinea infections (corporis, cruris, and pedis) is topical antifungals. Topical agents include azoles (clotrimazole, econazole, ketoconazole, efinaconazole, luliconazole, miconazole, oxiconazole, sertaconazole, sulconazole), allylamines (naftifine, terbinafine), ciclopirox, butenafine, and tolnaftate.2 Several of these topical preparations are available over the counter and often are adequate treatment for mild infections. Azoles tend to be more cost effective, although they are not quite as effective as allylamines.6 Topical antifungals should be applied once or twice a day for two to four weeks and should be continued for one week after clinical clearance.6 It is important to note that although topical nystatin is effective in treating Candida, it is not effective in dermatophyte infections.2 Photodynamic therapy is also a treatment option if other methods have failed.6

Infections including tinea manuum, tinea capitis, tinea unguium, and Majocchi’s granuloma; infections covering extensive areas; and infections that fail topical treatment usually require systemic antifungal medication. Oral agents include terbinafine, fluconazole, itraconazole, and griseofulvin. Prescribing guidelines for extensive infections, failure of topical treatment, and relapsing infections suggest terbinafine 250 mg daily for 14 days, fluconazole 50 mg daily for two to four weeks (six weeks for tinea pedis) or 150-200 mg once weekly for two to four weeks, itraconazole 100 mg daily for 15 days or 200 mg daily for seven days (may require longer treatment for tinea pedis and manuum), or griseofulvin microsize 500-1,000 mg daily for two to four weeks.2,6

The treatment of choice for tinea capitis and tinea barbae is griseofulvin. Terbinafine, itraconazole, and fluconazole are not FDA-approved for the treatment of tinea capitis or barbae.1 Adjunct treatment for tinea capitis includes antifungal shampoo (ketoconazole 2% or selenium sulfide 2.5% every other day), disinfecting grooming devices, and treatment of close contacts.1 In addition to antifungal treatment, products containing urea, glycolic acid, and lactic acid can be used in treating tinea pedis or tinea manuum.1,11 Tinea unguium can be extremely difficult to treat and often needs long-term systemic treatment.

Tinea incognito is a condition that occurs if a dermatophyte infection is misdiagnosed and treated with a topical corticosteroid. It can alter the clinical appearance of the infection and make diagnosis difficult. Treatment with corticosteroids also may lead to exacerbation of the infection and cause Majocchi’s granuloma.2 It is not recommended to use topical corticosteroids in conjunction with antifungals even though it may lead to more rapid resolution of inflammation and disease.2

Scabies

The scabies mite, Sarcoptes scabiei var. hominis, causes human scabies.12 The entire life cycle of the mite takes place in the epidermis, with the female mite laying three eggs daily. These eggs mature over the course of 10 days. The mites typically live on the human host for less than three days, except in the case of crusted scabies, in which they may survive up to seven days.12 Crusted scabies is a type of scabies found in individuals with compromised immune systems allowing the mite to survive with minimal symptoms and a large number of mites.12

The cutaneous lesions of scabies have a typical distribution. They often involve the web spaces of the fingers, flexural wrists, posterior neck, and umbilicus. Men often have lesions on the penis and scrotum, while women tend to have vulvar and areolar lesions. The burrow is the classic and distinct clinical finding in scabies and represents the track of the female mite to lay her eggs. Clinically, the burrow presents as a small white to grey winding plaque.12 The burrow may not always be present.12 Other cutaneous findings can include erythematous papules, pustules, or vesicles with excoriations often prominent. The diagnosis can be confirmed via skin scraping, curetting, or microscopic examination of transparent tape from an infested area. A skin biopsy can confirm the diagnosis.12

Symptoms of scabies can present two to six weeks after first exposure or within one to two days on second exposure. The primary symptoms are pruritus and skin lesions. Scabies commonly is known as one of the most pruritic rashes. The pruritus can be exacerbated by a hot shower or can cause insomnia, as it worsens at night. Household contacts often are plagued by the pruritus as well.

Standard treatment of scabies can be completed with two topical treatments of permethrin 5% cream given seven days apart (day 1 and day 8 applications).12 For adults, the cream is applied from the neck down on all skin surfaces at night and washed off in the morning. For elderly patients and infants (2 months of age and older), the cream also should be applied to the face and scalp. Patients with a sensitivity or allergy to formaldehyde or chrysanthemums should avoid using permethrin cream. Other topical medications that may be considered in scabies if resistant or allergic to permethrins include lindane 1% lotion/cream, sulfur ointment (5-10%), and crotamiton 10% lotion/cream. Ivermectin (200 to 400 mcg/kg) orally is also an excellent choice for resistant scabies, treating on day 1 and day 8 or 14.12 Ivermectin may cause central nervous system (CNS) toxicity in infants and young children. Lindane also has potential CNS toxicity in patients weighing less than 50 kg.12 Therefore, these medications are used only when absolutely needed.

Mimickers of Scabies

Lesions of lichen planus (see Figure 4) have a typical presentation on the flexor wrists, but are flat-topped, purple papules, often with a white reticulated veil, and will lack the characteristic burrow of scabies. Other mimickers could include viral exanthems, guttate psoriasis, secondary syphilis, drug reactions, or other arthropod assaults.

Polygonal, purple, flat-topped papules on the flexor wrist is a classic presentation of lichen planus.

Image courtesy of George Gibbons, MD.

Conclusion

Dermatophyte and scabetic infestations are extremely common worldwide and often are misdiagnosed. Patients without access to primary care may seek treatment for these conditions in the emergency department. More often this may be a secondary complaint. Numerous other dermatologic skin conditions may mimic these infections. A thorough cutaneous examination often can reveal clues to the diagnosis. Other lab modalities, such as skin scraping, biopsy, or culture, can further aid in making the correct diagnosis. Patients should be cautioned to seek further care if the rash does not respond to the treatment prescribed. If therapies discussed above fail to treat the skin rash, it is always prudent for physicians to refer to dermatology for further evaluation and treatment.

REFERENCES

  1. Elewski B, Hughey L, Sobera J, Hay R. Fungal Diseases. In: Bolognia JL, Jorizzo JL, Schaffer JV, eds. Dermatology. 3rd ed. Philadelphia: Elsevier Saunders; 2012: 1251-1284.
  2. Goldstein A, Goldstein B. Dermatophyte (tinea) infections. UpToDate. Available at: https://www.uptodate.com/contents/dermatophyte-tinea-infections. Accessed July 1, 2017.
  3. Marcellin L. Tinea Infections. Philadelphia: Elsevier; 2013.
  4. Hay R. Dermatophytosis (Ringworm) and Other Superficial Mycoses. In: Bennett JE, Dolin R, Blaser MJ, eds. Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases. 8th ed. Philadelphia: Elsevier Saunders; 2015.
  5. Liansheng Z, Xin J, Cheng Q, et al. Diagnostic applicability of confocal laser scanning microscopy in tinea corporis. Int J Dermatol 2013;52:1281-1282.
  6. Lebwohl M, Heymann WR, Berth-Jones J, Coulson I, eds. Treatment of Skin Disease: Comprehensive Therapeutic Strategies. 4th ed. Philadelphia: Saunders; 2014.
  7. Rezusta A, de la Fuente S, Gilaberte Y, et al. Evaluation of incubation time for dermatophytes cultures. Mycoses 2016;59:416-418.
  8. Sahoo AK, Mahajan R. Management of tinea corporis, tinea cruris, and tinea pedis: A comprehensive review. Indian Dermatol Online J 2016;7:77-86.
  9. Eckert JC, Ertas B, Falk TM, et al. Species identification of dermatophytes in paraffin-embedded biopsies with a new polymerase chain reaction assay targeting the internal transcribed spacer 2 region and comparison with histopathological features. Br J Dermatol 2016;174:869-877.
  10. Noriki S, Ishida H. Production of an anti-dermatophyte monoclonal antibody and its application: Immunochromatographic detection of dermatophytes. Med Mycol 2016;54:808-815.
  11. Elewski BE, Haley HR, Robbins CM. The use of 40% urea cream in the treatment of moccasin tinea pedis. Cutis 2004;73:355-357.
  12. Burkart CN, Burhart, CG, Morrell DS. Chapter 84: Infestations. In: Bolognia J, Jorrizzo JL, Shaffer JV, eds. Dermatology. 3rd ed. Philadelphia: Elsevier Saunders; 2012: 1423-1426.

Antifungal Resistance and New Strategies to Control Fungal Infections

Despite improvement of antifungal therapies over the last 30 years, the phenomenon of antifungal resistance is still of major concern in clinical practice. In the last 10 years the molecular mechanisms underlying this phenomenon were extensively unraveled. In this paper, after a brief overview of currently available antifungals, molecular mechanisms of antifungal resistance will be detailed. It appears that major mechanisms of resistance are essential due to the deregulation of antifungal resistance effector genes. This deregulation is a consequence of point mutations occurring in transcriptional regulators of these effector genes. Resistance can also follow the emergence of point mutations directly in the genes coding antifungal targets. In addition we further describe new strategies currently undertaken to discover alternative therapy targets and antifungals. Identification of new antifungals is essentially achieved by the screening of natural or synthetic chemical compound collections. Discovery of new putative antifungal targets is performed through genome-wide approaches for a better understanding of the human pathogenic fungi biology.

1. Introduction

The fungal kingdom encompasses an enormous diversity of taxa with varied ecological niches, life-cycle strategies, and morphologies. However, little is known of the true biodiversity of Kingdom Fungi. Of the 1.5 million species estimated to belong to this kingdom, only about 5% were formally classified. Many fungi are parasites for plants, animals, human, and other fungi. Plant pathogenic fungi are able to cause extensive damage and losses to agriculture and forestry including the rice blast fungus, Dutch elm disease, and chestnut blight. Some other fungi can cause serious diseases in humans, several of which may be fatal if left untreated. These include aspergillosis, candidosis, coccidioidomycosis, cryptococcosis, histoplasmosis, mycetomas, mucormycosis, and paracoccidioidomycosis. The so-called dermatophytic and keratinophilic fungi can attack eyes, nails, hair, and especially skin and cause local infections such as ringworm and athlete’s foot. Fungal spores are also a cause of allergies, and fungi from different taxonomic groups can provoke allergic reactions. In this paper, after a brief presentation of the medical impact of fungal infections at the global level and a summary of clinical treatments available today for clinicians, we will review the mechanisms underlying in vitro resistance to antifungals in fungal species of major importance in human medicine. Lastly, an overview of ongoing research undertaken to develop new therapeutic strategies to fight against fungal infections will be exposed.

2. Fungal Infections, Clinical Treatments, and Incidence of Antifungal Drug Resistance
2.1. Fungal Infections

At the beginning of the 20th century, bacterial epidemics were a global and important cause of mortality. In contrast, fungal infections were almost not taken into account. Since the late 1960s when antibiotic therapies were developed, a drastic rise in fungal infections was observed, and they currently represent a global health threat. This increasing incidence of infection is influenced by the growing number of immunodeficient cases related to AIDS, cancer, old age, diabetes, cystic fibrosis, and organ transplants and other invasive surgical procedures.

These infections are caused by two types of microorganisms: primary and opportunistic pathogens. Primary pathogens are naturally able to establish an infection in the healthy population. In contrast, opportunistic pathogens, among them commensal microorganisms of the healthy population, are able to develop infectious colonization of the human body when particular criteria, such as immunosuppression, are met. Fungal pathogens can be divided into two major groups: filamentous fungi and yeasts. Most of the primary pathogens are filamentous fungi, while most of the opportunistic pathogens are yeasts and some species of filamentous fungi are increasingly identified as opportunistic pathogens. It is also important to note that fungal infections can be classified in function of the tissue infected (see Table 1).


Body location Pathogen type Organ Most frequent genus Estimated incidence of
infection*

superficial primary Skin and hair Malassezia ~140,000,000 cases/year
cutaneous primary Skin and nails Trichophyton
Epidermophyton
Microsporum
~1,500,000,000 cases/year
mucosal opportunistic Vagina,
digestive tract,
urinary tract and
Candida ~75,000,000 cases/year
~9,500,000 cases/year
eye Aspergillus, Fusarium ~1,000,000 cases/year
systemic opportunistic any organ (lungs, brain, bloodstream etc.) Candida
Aspergillus
Cryptococcus
Histoplasma
Pneumocystis
Coccidioidomyces
and so on
~300,000 cases/year
~350,000 cases/year
~1,000,000 cases/year
~500,000 cases/year
>200,000 cases/year
up to 300,000 cases/year


*adapted from “The Fungal Research Trust. How common are fungal diseases? Fungal Research Trust 20th Anniversary meeting. London June 18th 2011.”

Superficial mycoses, such as tinea versicolor, are limited to the most external part of the skin and hair. These infections are most frequently caused by the species Malassezia globosa and M. furfur, which are estimated to be carried by 2% to 8% of the healthy population worldwide but could lead to tinea versicolor in some conditions that are still unclear [1].

Cutaneous and subcutaneous mycoses caused by dermatophytes fungi affect keratinized structures of the body. The most frequently involved dermatophyte genera are Trichophyton, Epidermophyton, and Microsporum. In most cases, cutaneous fungal infections require a challenge of immune system, and their incidence varies depending on the site of infection. For example, onychomycoses are very frequent in the global population, with an incidence varying from 5 to 25% [2].

Mucosal infections are mostly caused by opportunistic yeasts, and those belonging to the Candida genus are by far the most frequent. Vaginal, esophageal, oropharyngal, and urinary tract candidiasis are very frequent in immunocompromised patients. For example, esophageal candidiasis is associated with the entry into the clinical phase of AIDS and during the 1980s more than 80% of seropositive patients developed such an infection [3]. Fungal infections, of the eye are also classified as mucosal fungal infections, but are caused more frequently by Fusarium or Aspergillus species rather than Candida species.

Theoretically systemic mycoses may involve any part of the body, and a lot of species formerly considered as nonpathogenic are now recognized opportunistic pathogens responsible for deep-seated mycoses. These infections, with symptoms ranging from a simple fever to a severe and rapid septic shock, are very common in immunocompromised patients and are frequently associated with an elevated mortality rate. The most frequent pathogens involved in systemic fungal infections are Candida, Pneumocystis, Histoplasma, Aspergillus, Cryptococcus, Mucor, Rhizopus, and Coccidioidomyces [4–6].

2.2. Antifungal Agents

Despite extensive research dedicated to the development of new therapeutic strategies, there are only a limited number of available drugs to fight against invasive fungal infections. Indeed, only four molecular classes that target three distinct fungal metabolic pathways are currently used in clinical practice to treat essentially systemic fungal infections: fluoropyrimidine analogs, polyenes, azoles, and echinocandins. Several other classes, such as morpholines and allylamines are only used as topical agents due to either poor efficacy, or severe adverse effects when administered systemically.

2.2.1. Fluoropyrimidines

Fluoropyrimidines, of which only 5-fluorocytosine (5-FC) and 5-fluorouracil (5-FU) are used in human medicine, are synthetic structural analogs of the DNA nucleotide cytosine (Figure 1).

5-FC was synthesized in 1957 by Duschinsky et al., initially as an antitumor therapy [7]. In 1963, Grunberg and coworkers discovered its antifungal potential by means of murine models of cryptococcosis and candidiasis [8]. Several years later 5-FC was successfully used for the treatment of systemic candidiasis and of cryptococcal meningitis [9].

5-FC possesses a broad range of activity. This drug is active against Candida and Cryptococcus genera. 5FC activity on Phialophora, Cladosporium, and Aspergillus genera is much less limited. 5-FC is also active against protozoa belonging to Leishmania and Acanthamoeba genus [10].

Due to its high hydrosolubility and small size, 5-FC possesses interesting pharmacokinetic properties, since it diffuses rapidly throughout body even when orally administered [12]. Generally, it produces negligible side effects, despite some severe adverse effects, such as hepatotoxicity or bone marrow lesions [11, 13–15], occurring in rare cases [16]. Surprisingly, these side effects are identical to those observed with 5-FU treatment, despite the fact that humans do not possess a cytosine deaminase enzyme that is responsible for the conversion from 5-FC into 5-FU in fungal cells [17, 18]. Some data suggest that the intestinal microbiome could be responsible for the 5-FU production and the observed side effects [19].

Despite its numerous pharmacological advantages, the use of 5-FC in clinical practice is decreasing because of the frequent occurrence of innate or acquired resistance to this drug in fungal pathogens. Thus, with few exceptions [20], 5-FC is never used as monotherapy but always in combination with another antifungal, such as amphotericin B [21, 22]. However, the elevated renal and liver toxicities of amphotericin B, that further increase 5-FC hepatotoxicity, has led to combination therapy of 5-FC more frequently with azole drugs.

5-FC itself has no antifungal activity, and its fungistatic properties are dependent upon the conversion into 5-FU [16, 20, 23]. The drug rapidly enters the fungal cell through specific transporters, such as cytosine permeases or pyrimidine transporters [24], before it is converted into 5-FU by the cytosine deaminase [16]. 5-FU itself is converted into 5-fluorouracil monophosphate (5-FUMP) by another enzyme, uridine phosphoribosyltransferase (UPRT). 5-FUMP can then be either converted into 5-fluorouracil triphosphate, which incorporates into RNA in place of UTP and inhibits protein synthesis, or converted into 5-fluorodeoxyuridine monophosphate, which inhibits a key enzyme of DNA synthesis, the thymidylate synthase, thus inhibiting cell replication (Figure 2) [16, 25, 26].

2.2.2. Polyenes

More than 200 molecules belonging to the chemical class of polyenes have an antifungal activity, most of them being produced by Streptomyces bacteria. However, only three possess a toxicity allowing their use in clinical practice: amphotericin B (AmB), nystatin, and natamycine.

Streptomyces bacteria synthesize polyenes through a gene cluster phylogenetically conserved within these species. This cluster contains genes coding for several polyketide synthases, ABC (ATP-binding cassette) transporters, cytochrome P450-dependent enzymes, and enzymes responsible for the synthesis and the binding of the mycosamine group [27]. Although it is possible to synthesize polyenes chemically, they are still produced from Streptomyces cultures for economic reasons.

Polyenes are cyclic amphiphilic organic molecules known as macrolides. Most of them consist of a 20 to 40 carbons macrolactone ring conjugated with a d-mycosamine group. Their amphiphilic properties are due to the presence of several conjugated doublebounds on the hydrophobic side of the macrolactone ring, and to the presence of several hydroxyl residues on the opposite, hydrophilic side (Figure 3) [28].

Polyene drugs target ergosterol, the main sterol component of fungal membranes. Their amphiphilic structure allows them to bind the lipid bilayer and form pores. Magnetic nuclear resonance data suggest that eight AmB molecules bind eight ergosterol molecules through their hydrophobic moieties, with their hydrophilic sides forming a central channel of 70–100 nm in diameter (Figure 4). Pore formation promotes plasma membrane destabilization, and channels allow leakage of intracellular components such as K+ ions, responsible for cell lysis [28].

While structural data suggest that polyenes target ergosterol, and despite the fact that their binding to ergosterol was experimentally demonstrated [29–31], controversy remains over a possible intracellular mode of action. Some research has suggested that polyene drugs are able to induce an oxidative stress (particularly in C. albicans [32, 33]) as well as their activity seems to be reduced in hypoxic conditions [34].

Polyenes possess a lower but non-negligible affinity for cholesterol, the human counterpart of ergosterol. This slight affinity for cholesterol explains the high toxicity associated with antifungals and is responsible for several side effects [28]. For this reason, only AmB is given systemically, while nystatin and natamycin are only used locally or orally. These two last molecules fortunately possess a very limited systemic activity, since their absorption trough gastrointestinal mucosa is almost nonexistent [35, 36].

For these reasons, AmB is the most used polyene antifungal for systemic infections. Due to its high hydrophobicity and poor absorption through the gastrointestinal tract, it is necessary to administer AmB intravenously [28]. However, AmB administration is accompanied with adverse effects, mostly at the level of kidneys and liver. New AmB formulations, such as liposomal AmB or lipid AmB complexes, minimize such side effects [37].

For more than 40 years, AmB was one of the goldstandards for the treatment of systemic fungal infections due to the low occurrence of acquired or innate resistance to this drug and also because of its broad range of activity [38]. Indeed, AmB is active against most yeasts and filamentous fungi. It is recommended for the treatment of infections caused by Candida, Aspergillus, Fusarium, Mucor, Rhizopus, Scedosporium, Trichosporon, Cryptococcus, and so on. AmB is also widely used to treat parasitic infections such as leishmaniasis and amibiasis [28]. Natamycin and nystatin are active against fungi belonging to the genera Cryptococcus, Candida, Aspergillus, and Fusarium. If nystatin is not used to treat molds infections, this drug is frequently used for the treatment of cutaneous, vaginal, and esophageal candidiasis, and natamycin can be used for the treatment of fungal keratosis or corneal infections [35].

2.2.3. Azoles

Azoles are by far the most commonly used antifungals in clinical practice, and consequently, they are also the mostly studied by the scientific community regarding their mode of action, their pharmacological properties, and the resistance mechanisms developed by microorganisms. Azole antifungals are also largely studied by pharmaceutical companies, who seek to enhance their efficacy and to develop the perfect antifungal.

Azoles are cyclic organic molecules which can be divided into two groups on the basis of the number of nitrogen atoms in the azole ring: the imidazoles contain two nitrogen atoms, and the triazoles contain three nitrogen atoms (Figure 5) [39].

Azole drugs target the ergosterol biosynthetic pathway by inhibition of a key enzyme, the lanosterol 14alpha demethylase, encoded be the ERG11 gene. This inhibition occurs through the binding of the free nitrogen atom of the azole ring to the iron atom of the heme group of the enzyme. The resulting accumulation and metabolism of 14alpha methylated sterol species leads to the synthesis of toxic compounds, which are unable to successfully replace ergosterol [40].

The first azole was synthesized in 1944 by Woolley [41], but it was not until 1958 that scientific community began to consider azoles as potential antifungal agents. In late 1960s, clotrimazole, econazole, and miconazole became available for treatment [42]. However, their use was restricted to external application due to their high toxicity when administered orally [43, 44]. In 1968, miconazole became the first antifungal available for parenteral injection, but due to its toxicity and relatively limited range among fungal species [45], its use decreased until it was no longer commercialized.

In 1981, the Food and Drug Administration (FDA) approved a new antifungal, ketoconazole, developed by Heeres and his coworkers [46]. This drug was the only antifungal available for treatment of systemic fungal infections caused by yeasts for the following ten years. However, there are several drawbacks to this drug. It is poorly absorbed when administered orally, and no ketoconazole form has ever been developed for intravenous injection. Moreover, it cannot cross the cerebrospinal barrier and is less active in immunosuppressed patients [42, 47–49]. It causes some severe side effects such as a decrease in testosterone or glucocorticoids production and liver and gastrointestinal complications [50–52]. Lastly, numerous interactions with other drugs were described. For these reasons, the triazoles were developed.

Fluconazole became available for use by clinicians in 1990 and provided many advantages over the use of imidazoles. Fluconazole is highly hydrosoluble and therefore can be easily injected intravenously. It is almost completely absorbed through the gastrointestinal tract, and it diffuses throughout the whole body, including cerebrospinal fluid [53, 54]. Fluconazole is suitable for the treatment of superficial candidiasis (oropharyngal, esophageal, or vaginal), disseminated candidiasis, cryptococcal meningitis, coccidioidomycosis, and cutaneous candidiasis. Due to its good pharmacokinetic properties as well as its broad spectrum of activity, fluconazole was the gold-standard treatment of fungal infections during the 1990s. Unfortunately, the overprescription of this drug by physicians for prophylaxis or treatment led to an increase in resistance to azole drugs. Moreover, fluconazole is almost ineffective against most molds.

Itraconazole was approved and made available by the FDA in 1992. This triazole possesses a broad spectrum of activity across fungal species comparable to this of ketoconazole and wider than fluconazole. Moreover, it is less toxic than ketoconazole and replaced it for treatment of histoplasmosis, blastomycosis, and paracoccidioidomycosis. Contrary to fluconazole, it is also used for the treatment of infections due to species belonging to the genera Aspergillus and Sporothrix [55]. However, itraconazole is hydrophobic and is thus more toxic than fluconazole. Itraconazole is only indicated for the treatment of onychomycosis, of superficial infections, and in some cases for systemic aspergillosis [56]. A new itraconazole formulation with an enhanced absorption and a decreased toxicity was approved by FDA in 1997 [57]. An injectable formulation of itraconazole was made available in 2001 [58].

Fluconazole and itraconazole are still not the perfect antifungals, since they have some nonnegligible drug interactions with such drugs that are used in chemotherapy or with AIDS treatment. These interactions can result in a decrease in azole concentration or even to an increase in toxicity [59]. Furthermore itraconazole and fluconazole are ineffective against some emerging pathogens like Scedosporium, Fusarium, and Mucorales, and resistance to azoles is increasingly reported [60].

So-called new generation triazoles have also been developed. Voriconazole and posaconazole were approved by FDA in 2002 and 2006, respectively. Ravuconazole is currently under clinical trial phase of drug development. They possess a wide range of activity, since they are active against Candida, Aspergillus, Fusarium, Penicillium, Scedosporium, Acremonium, and Trichosporon, and dimorphic fungi, dermatophytes, and Cryptococcus neoformans [61, 62]. While new generation triazoles were shown to be more effective against Candida and Aspergillus [62], compared to classical triazoles their side effects and drug interactions are similar to those observed with fluconazole and itraconazole [63]. Likewise, fungal isolates resistant to classical triazoles are also cross-resistant to new generation triazoles.

2.2.4. Echinocandins

Echinocandins constitute the only new class of antifungals made available for clinicians to fight invasive fungal infections within the past 15 years [64]. Three echinocandins were currently approved for clinical use by the FDA in United States and later by the European Agency for the Evaluation of Medicinal Products (EMEA): caspofungin in 2001 by the FDA and in 2002 by the EMEA, micafungin in 2005, and lastly anidulafungin in 2006.

Echinocandins are synthetic derivatives of lipopeptides (Figure 6). These lipopeptides are naturally produced by several fungal species: Aspergillus rugulovalvus synthesizes caspofungin B, Zalerion arboricola synthesizes pneumocandin B, and Papularia sphaerosperma synthesizes papulacandin. Echinocandins are noncompetitive inhibitors of β(1-3)-glucan synthase, an enzyme that catalyzes the polymerization of uridine diphosphate-glucose into β(1-3) glucan, one of the structural components responsible for the maintenance of fungal cell-wall integrity and rigidity [65, 66]. β(1-3)-glucan synthase consists of an activating and a catalytic subunit encoded by FKS genes. In most fungi, two FKS genes are found within the genome. It has been shown in the model organism Saccharomyces cerevisiae that FKS1 is expressed during the vegetative growth phase and FKS2 during sporulation [67]. Echinocandins are able to inhibit both isoforms of the enzyme [68]. Inhibition of β(1-3)-glucan synthase leads to cell wall destabilization and to the leakage of intracellular components, resulting in fungal cell lysis [69].

These drugs are poorly absorbed in the gastrointestinal tract because of their high molecular weights and are therefore only used intravenously. Their pharmacologic properties are one of the reasons responsible for the approval of echinocandins by the FDA and the EMEA. These molecules possess a low toxicity (very rare side effects were reported) and are slowly degraded, and a daily injection is sufficient, and contrary to other antifungals, interactions between echinocandins and other drugs are rare [64]. Combined therapy between echinocandins and AmB or another azole often leads to a synergistic effect or at least to an additive effect [70, 71].

Another reason for which the echinocandins were approved is their activity spectrum. Indeed, echinocandins are active against most fungal species, including Candida and Aspergillus. For still unclear reasons, these molecules are fungicidal in Candida but only fungistatic in Aspergillus [72, 73]. Moreover, fungicidal activity of echinocandins is species and isolate dependent within the Candida genus [74]. There exist several species within the fungal kingdom for which the echinocandins are ineffective. Such species include Cryptococcus neoformans [75] or species belonging to Trichophyton and Fusarium genera. Other species have an intermediate susceptibility to echinocandins, such as Scedosporium apiospermum, S. prolificans, and Cladophialophora bantiana [72]. However, echinocandins constitute a good alternative to fight against fungal infections and most of treatment of infections for which classical therapy with azoles or polyenes failed are successfully managed with echinocandins [64]. Therefore, caspofungin is indicated for the treatment of candidemia and invasive candidiasis, for fungal infection prophylaxis, and for the treatment of invasive aspergillosis for which itraconazole, voriconazole, or AmB is ineffective. Micafungin is used for treatment of candidemia and is particularly indicated for fungal infection prophylaxis in bone-marrow transplant patients. Anidulafungin has no particular indications, but its main advantage is its slow degradation in the body without liver or kidney involvement, thus it can be used in patients with liver and/or kidney insufficiencies [76].

What makes echinocandins unique is their fungal target. For many years, the fungal cell wall was considered to be a promising target for the development of new antifungal molecules [68]. The fungal cell wall contains elements that have no equivalents in human [77]. Its integrity is necessary for the fungal survival, since it provides a physical barrier against the host immune cells or against other microorganisms. Cell wall integrity is also responsible for osmolarity homeostasis and the maintenance of cell shape and size. Cell wall is also indispensable to essential enzymatic reactions and as an important role in cell-cell communication. The internal layer of the cell wall is composed of a β(1-3)-glucans and chitin web, in which are included some mannoproteins, while external layer is composed of mannoproteins (Figure 7) [77].

2.2.5. Other Antifungal Agents

Considering that the ergosterol biosynthetic pathway requires several enzymes that are unique to fungi, they constitute good targets for antifungal therapy, and three minor ergosterol biosynthesis inhibitors are used as topical antifungals. The allylamines and thiocarbamates, such as terbinafine and tolnaftate, both inhibit the ERG1-encoded enzyme, squalene epoxidase. The morpholines such as amorolfine act by inhibiting two different enzymes of the pathway, the Δ7,8-isomerase (encoded by ERG24) and the C14-reductase (encoded by ERG2). Despite their wide spectrum of activity, these antifungal agents are essentially used to treat dermatophyte infections such as tinea capitis, tinea pedis, and onychomycosis, because they do present numerous side effects.

Ciclopirox is also used as a topical antifungal agent, but its mode of action remains poorly understood in fungi [78, 79]. Another drug, griseofulvin, inhibits mitosis by interfering with microtubules function [80].

2.3. Incidence of

In Vitro Resistance in Fungal Infection

The incidence of fungal infections has drastically increased over the past three decades and was simultaneously accompanied by increased acquired and innate resistance to antifungal drugs. However, antifungal resistance occurrence has to be considered independently for each antifungal class and for each fungal genus. Moreover, epidemiological data regarding incidence of resistance among fungal species is not identically distributed worldwide [81–83]. Lastly, clinical resistance, defined as the treatment failure in the patient, does not always correlate with in vitro resistance, measured as an increase in minimal inhibitory concentration of a drug. In this paper, only in vitro resistance incidence will be described.

2.3.1. 5-Fluorocytosine

5FC resistance is a very common phenomenon [9, 16, 84]. The development of resistance can be intrinsic, as is the case for C. tropicalis, or acquired through the selection of resistant mutants after antifungal exposure. Within the Candida genus, 7% to 8% of clinical isolates are resistant to 5FC, and this frequency increases to 22% when only nonalbicans Candida species are considered. One to two percent of Cryptococcus neoformans clinical isolates are resistant to 5FC [85]. Filamentous fungi such as Aspergillus and dermatophytes are not susceptible to 5FC.

2.3.2. Polyenes

Despite the reported increase of polyene resistance, it remains a relatively rare event in clinical isolates of fungal pathogens [86], probably in relation with their mode of action, and the absence of systematic and standardized determination of susceptibility of clinical isolates [87]. The incidence of strains resistant to polyenes may thus be largely underestimated. Most fungal species are considered as susceptible to polyene drugs. However, some of them are intrinsically poorly susceptible to these antifungals, such as C. glabrata, Scedosporium prolificans, or Aspergillus terreus [38]. Some species are more prone to acquire polyene resistance. Among yeasts, one may cite C. lusitaniae [88, 89], C. guilliermondii [88], C. krusei [38], and Trichosporon beigelii and among filamentous fungi Scedosporium apiospermum and Sporothrix schenckii [90, 91].

2.3.3. Azoles

The early 1990s was the start of a drastic increase in resistance among fungal clinical isolates. However, the improvement of antifungal therapeutic strategies throughout the last several years has helped to stabilize resistance frequencies. Increase in azoles use selected less susceptible species as well as those able to develop resistance. This led to a shift in the pathogenic fungal species encountered in clinic.

2.3.4. Echinocandins

Echinocandins resistance is a rare event [92]. For example, it is estimated that more than 97% of clinical isolates belonging to the Candida genus are susceptible to these drugs [93, 94]. Contrary to acquired resistance in other fungi, intrinsic echinocandin resistance in Cryptococcus neoformans is not linked with a FKS1 or FKS2 mutation. Indeed, C. neoformans  β(1–3)-glucan synthase is inhibited by echinocandins, but this yeast is able to grow in the presence of high concentrations of these drugs. C. neoformans resistance to echinocandins seems to be due to a particular cell-wall polysaccharides composition in this species [95].

2.3.5. Incidence of

In Vitro Resistance on Patient Care

As antifungal in vitro resistance poorly correlates with clinical outcome, better attention was needed to define parameters that produced reproducible and reliable intra- and interlaboratory results. For this purpose, two standardized methods for the testing of yeast and mould isolates (CLSI and Eucast) are recognized as the gold standards for drug susceptibility testing [96–98]. These standardized approaches produce susceptibility results comparable between laboratories, which may help to establish breakpoints for antifungal agents (see [96–98] for details). These breakpoints, defined as susceptibility ranges, together with pharmacokinetic and pharmacodynamic analyses and identification of resistance mechanisms, help to assess the in vivo activity of antifungal agents in invasive disease and therefore clinical outcome [99, 100].

3. Drug Resistance Molecular Mechanisms

Microorganisms develop mechanisms to counteract the fungicidal or fungistatic effects of all antifungals classes that are based on three major mechanisms, namely, (i) reducing the accumulation of the drug within the fungal cell, (ii) decreasing the affinity of the drug for its target, and (iii) modifications of metabolism to counterbalance the drug effect (Table 2). The molecular mechanisms leading to azole resistance have been most studied in yeast, and taking them as an example, such mechanisms are divided into four categories (Figure 8) [101]: (i) decrease in azole affinity for their target, (ii) increase in azole target copy number, (iii) alteration of ergosterol biosynthetic pathway after azoles action, and (iv) decrease in intracellular azole accumulation. In some highly resistant clinical isolates, sampled from long-term treated patients, several mechanisms of resistance are often combined [102, 103]. This increase in resistance along antifungal treatment is due to the sequential acquisition of different mechanisms [104–106]. In the following section, the molecular basis of the resistance mechanisms to antifungals will be described.


Antifungal agent Mode of action and cellular target Mechanism of resistance

polyenes binding to ergosterol absence of ergosterol (loss of function mutation in ERG3 or ERG6)
decrease of ergosterol content in cells

azoles inhibition of cytochrome p450 function: 14α-lanosterol demethylase (ERG11) sterol desaturase (ERG5) efflux mediated by multidrug transporters
decrease of affinity in Erg11p by mutations
upregulation of ERG11
alterations in the ergosterol biosynthetic pathway

allylamines inhibition of squalene epoxidase (ERG1) unknown

morpholines inhibition of sterol reductase (ERG24) and the isomerase (ERG2) unknown

5-fluorocytosine inhibition of nucleic acids synthesis defect in cytosine permease
deficiency or lack of enzymes implicated in the metabolism of 5-FC
deregulation of the pyrimidine biosynthetic pathway

echinocandins inhibition of β-1,3 glucan synthase (FKS1&2) alteration of affinity of echinocandins for β(1,3)-glucan synthase

3.1. Increase of Drug Efflux
3.1.1. ABC Transporters

CDR1 and CDR2 (Candida drug resistance 1 and 2) from C. albicans are the two major ABC transporters involved in azole resistance in this species. CDR1 and CDR2 can be coordinately upregulated in some azole-resistant strains or by exposure to a wide variety of chemically unrelated inducers such as terbinafine, amorolfine, fluphenazine, or steroid hormones. Several cis-acting regulatory elements responsible for the regulation of these two genes were identified by several investigators [107–111]. Promoter deletion studies have revealed 5 different regulatory elements in the CDR1 promoter including a BEE (basal expression element), a DRE (drug responsive element), two SREs (steroid responsive element), and a NRE (negative regulatory element) (see Table 3 for details). Internal deletions of the BEE and DRE motifs in the CDR1 promoter affect basal CDR1 expression and drug-induced expression, respectively [107]. SRE1 and SRE2 were reported to be involved in the response to steroid hormones: with SRE1 responding only to progesterone and SRE2 to both progesterone and β-oestradiol [108]. Finally, the deletion of the NRE motif leads to an increase in the basal expression of CDR1 [110, 111]. In contrast to CDR1, the CDR2 promoter contains only a DRE motif (Table 3) [107]. Among these different cis-acting elements, DRE was the only element involved in constitutive high expression and in transient upregulation of both CDR1 and CDR2. This DRE sequence was functionally analyzed by systematic mutation each base of the initially described DRE sequence [107, 112]. The data obtained from systematic mutational studies are in agreement with ChIP-Chip assays performed with the trans-acting factor binding to the DRE [113]. In other Candida species, functional homologues to CDR1 and CDR2 were described as involved in drug resistance. In C. glabrata, CgCDR1 and CgCDR2 (formerly denoted PDh2) as well as SNQ2 (another ABC transporter coregulated with CgCDR1 and CgCDR2) are upregulated in azole-resistant clinical isolates and participate in azole resistance [114–118]. All the three genes contain cis-acting elements in their promoters, so-called PDRE. These elements are similar to those described in S. cerevisiae for PDR5, an ABC transporter involved in drug resistance of S. cerevisiae [119, 120]. Disruptions of CgCDR1 and CgCDR2 lead to hypersusceptibility to fluconazole, cycloheximide, and chloramphenicol [115, 117]. In both C. albicans and C. glabrata, CDR1 was shown to be the main contributor in azole-resistance among the ABC-transporters [121–123]. Other ABC-transporters from C. dubliniensis (CdCDR1 and CdCDR2) [124, 125], C. krusei (ABC1 and 2) [126, 127], C. tropicalis (CDR1-homologue), and C. neoformans (CnAFR1, AntiFungal Resistance 1) were reportedly upregulated in azole-resistant isolates. In A. fumigatus, atrF, and AfuMDR4 are upregulated in itraconazole-resistant strains [128–130]. The cis-acting regulatory elements of these genes are still awaiting in-depth dissection analysis. The overexpression of ABC-transporters have also been identified as a resistance mechanism to azole in Aspergillus nidulans [131, 132].


Organism Gene Regulatory element Position respectively to the ATG Trans-acting factor
Name Sequence


ABC transporters
BEE −960 to −710 ?
DRE ACGGATATCGGATATTTTTTT −460 to −439 Tac1
CDR1 NRE CTGATTGA −335 to −328 ?
C. albicans SRE1 GGAGTAGCAAGTGTGTCAAGAACCTGAATTC −740 to −711 ?
SRE2 TTATCCGAAACGCTTTACTCCTCTATTATT −691 to −661 ?
CDR2 DRE ACGGAAATCGGATATTTTTTT −221 to −201 Tac1
C. glabrata CgCDR1 PDRE TTCCGTGGAA −1201 to −1192 CgPdr1
CgCDR2 PDRE TTCCGTGGAA −560 to −551 CgPdr1


MFS transporters
HRE/YRE −561 to −520 Cap1/?
BRE/
MDRE
ACGGTAAAATCCTAATTGGGAAAAATACCGAGAATGA −296 to −260 Mcm1/Mrr1
C. albicans CaMDR1 AR1 −397 to –301 ?
AR2 −588 to –500 ?
AR3 −287 to −209 ?
C. glabrata CgFLR1 YRE3 TTAGTAA −372 to −366 CgAp1


ERG11
C. albicans ERG11 ARE AATATCGTACCCGATTATGTCGTATATT −224 to −251 Upc2
C. glabrata ERG11 SRE Upc2A

The identification of trans-acting factors regulating ABC-transporters in pathogenic fungi relied first on the well-described S. cerevisiae PDR network as a model [138–142]. Since the Zn2-Cys6 transcription factors PDR1/PDR3 are master regulators of this network in S. cerevisiae, an in silico search for PDR1/PDR3 homologues in fungal genomes was performed. Data so far available found only one functional homologue in C. glabrata [120]. CgPdr1p has 40% and 35% identity with Pdr1p and Pdr3p, respectively [143], and was able to complement a pdr1Δ S. cerevisiae mutant strain. Likewise, PDR1 deletion in C. glabrata leads to a loss of CgCDR1 and CgCDR2 regulation and to a sharp decrease in azole MICs. [144]. Three studies have identified separate gain-of-function mutations in CgPDR1 alleles of azole-resistant strains which are responsible for constitutive high expression of CgCDR1, CgCDR2, SNQ2, and CgPDR1 itself (Figure 9) [120, 145, 146].

Attempts to identify C. albicans PDR1/3 functional homologues were undertaken to complement the absence of PDR1/PDR3 in S. cerevisiae by genetic screens. Several genes were identified including FCR1 and FCR3 (FluConazol Resistance) [147–149] and SHY1-3 (Suppressor of Hypersusceptibility) [150] (formerly, resp., named CTA4, ASG1 and ATF1). FCR1, CTA4, ASG1, and ATF1 encode Zn2-Cys6 transcription factors, while FCR3 encodes a bZip transcription factor. Even though FCR1 was able to restore PDR5 expression in a pdr1Δ/pdr3Δ S. cerevisiae mutant strain, its disruption in C. albicans resulted in decreased susceptibility to fluconazole, suggesting that FCR1 acts as a negative regulator of fluconazole susceptibility [147]. Nevertheless, the target genes of FCR1 in C. albicans are not yet known. Up to now, the relevance of FCR3 in azole resistance has not been addressed in C. albicans. CTA4, ASG1, and ATF1 expression in S. cerevisiae could restore PDR1/PDR3 functions in S. cerevisiae; however, their disruption in C. albicans did not affect azole susceptibility and expression of CDR1 and CDR2 [150]. An additional regulator of CDR1 was identified by a genetic screen in S. cerevisiae with a LacZ reporter system under the control of the CDR1 promoter. A C. albicans gene was subsequently identified that encodes for a protein CaNdt80p similar to the S. cerevisiae meiosis specific transcription factor Ndt80p. Disruption of CaNDT80 in C. albicans was shown to affect basal expression levels of CDR1 in C. albicans and reduce the ability of this gene to be upregulated in the presence of miconazole [151, 152]. More recently, Ndt80p was shown to have a global effect on azole-resistance through is regulon which includes many genes involved in ergosterol metabolism [153].

The release of the entire data from the C. albicans genome sequence has encouraged other approaches for identifying trans-regulators of CDR1 and CDR2. Since the DRE motifs present in the promoter of CDR genes contains two CGG triplets that are potentially recognized by Zn2-Cys6 transcription factors (TF) [154–157], it was likely that one of the 78 ORFs encoding proteins with Zn2-Cys6 signatures could be involved in the regulation of CDR1 and CDR2. Interestingly, genome data revealed that three of these ORF (the so-called “zinc cluster”) were located in tandem close to the mating type locus (MTL) at a distance of 14 kb [158]. Homozygosity at the MTL locus is associated with the development of azole resistance in C. albicans [159], thus indicating that one the genes of the zinc cluster could control CDR1 and CDR2 expression. As a matter of fact, deletion of one of these Zn2-Cys6 TF-encoding genes in an azole-susceptible strain led to increased drug susceptibility and loss of transient CDR1 and CDR2 upregulation in the presence of inducers. This gene was named TAC1 for transcriptional activator of CDR genes [158]. Consistent with the mutant phenotype, Tac1p can bind in vitro and in vivo to the DRE [112, 158]. However, TAC1 is not involved is the basal expression of CDR1 controlled at least by the BEE [158]. Hyperactive alleles that confer constitutive high CDR1 and CDR2 expression, and therefore drug resistance to a tac1Δ/Δ mutant strain of TAC1, were isolated from azole-resistant strains. Wild-type and hyperactive alleles differed by point mutations defined as gain-of-function mutations (GOF). Up to now, at least 15 GOF were described in TAC1 at 12 different positions [112, 158, 160, 161] (Figure 9). Wild-type and hyperactive alleles are co-dominant for the expression of their phenotypes [112, 158, 160, 161], and because of this property, high drug resistance levels correlate with homozygosity of hyperactive alleles. Interestingly, the TAC1 locus and the associated MTL are rendered homozygous in the development of azole resistance. Such events are accomplished by rearrangements on chromosome 5 including mitotic recombinations on one chromosome 5 arm or the loss of one chromosome 5 homologue followed by duplication [160]. Increase of resistance can still be obtained by isochromosome formation with the left arm of the chromosome 5. This allows for the increase of drug resistance genes present on this chromosome (among which TAC1 and ERG11) and thus can contribute to drug resistance increase [160–164]. Up to this date, regulation of Tac1p activity remains unknown.

3.1.2. Major Facilitator Superfamily (MFS) Transporters

In C. albicans, MDR1 (MultiDrug Resistance 1, previously named BENr for Benomyl resistance) is a transporter currently shown to be the only MFS transporter involved in azole resistance of clinical isolates [165, 166]. MDR1 is not usually expressed at detectable levels in fluconazole-susceptible isolates, but is constitutively upregulated in some fluconazole-resistant isolates. As for CDR1 and CDR2, MDR1 can be specifically transiently upregulated by drugs such as benomyl, cycloheximide, methotrexate, and several oxidizing agents [165]. MFS transporters are known to be involved in azole resistance of other fungal species. Homologues of MDR1 in C. dubliniensis and C. tropicalis, named CdMDR1 and CtMDR1, respectively, are upregulated in azole-resistant strains [167–170]. In A. fumigatus, in vitro-generated itraconazole-resistant isolates show constitutive high expression level of the MFS transporter, AfuMDR3 [128]. The role of cis-acting regulatory elements in resistance was investigated in the C. albicans MDR1 gene by separate studies. Two of the studies undertaken by Rognon et al. and Riggle and Kumamoto identified a similar region, called BRE (benomyl response element) or MDRE (MDR1 drug resistance element) respectively. This region is responsible for the constitutive high expression of MDR1 in fluconazole-resistant isolates [171, 172] and was also shown to be responsible for the response to benomyl [172]. A second regulatory element involved in the response of MDR1 to oxidative stress is designated HRE (H2O2 response Element). This region contains two YRE (YAP1 response element) motifs [173], one perfectly conserved (-532 TTAGTAA-526) and the other with two mismatches (-549 TAACTAT-543). Interestingly, the HRE is not required for constitutive upregulation of MDR1 in azole-resistant isolates. A separate study undertaken by Hiller et al. described three distinct cis-activating regions (1, 2, and 3) in MDR1. Region 2, which overlaps with encompassing the HRE, was implicated in benomyl-dependent MDR1 response [174]. Region 1 and 3, close to the BRE/MDRE region, were required for a constitutive high expression of MDR1 in an azole-resistant isolate.

MDR1 expression was shown to be regulated by at least four trans-acting factors: Cap1p [175–177], Mrr1p [178, 179], Upc2p [180, 181], and Mcm1p [182]. Nucleotide sequence data of cis-acting elements has provided some clues to their identification. When comparing the MDR1 cis-acting elements with existing transcription factor binding site databases, several putative trans-acting elements were identified. As mentioned above, the HRE of MDR1 contains Yap1p binding sites. The bZip transcription factor Cap1 was shown to directly interact with the cis-acting domains [177] and to be involved in drug resistance [175]. The BRE/MDRE motif contains a perfect match for the Mads-box transcription factor Mcm1p in its sequence. Mogavero et al. showed that Mcm1p acts as a coregulator for Cap1 and Mrr1p and is not required for MDR1 upregulation by H2O2 but is required for full MDR1 induction by benomyl [182]. Genome-wide transcriptional analyses of clinical isolates that exhibit MDR1upregulation permitted the identification of a Zn2-Cys6 transcription factor that is coregulated with MDR1 [179]. Deletion of MRR1 in azole-resistant strains abolishes the constitutive overexpression of MDR1, therefore identifying Mrr1p as a central regulator of MDR1. Like for TAC1, two types of alleles were distinguished for MRR1. Wild-type alleles are needed for a transient upregulation of MDR1 by drug exposure. In contrast, hyperactive alleles confer constitutive overexpression of MDR1 and therefore also confer increased resistance to fluconazole [179]. Wild-type and hyperactive alleles differ by GOF mutations and until now, 14 GOF mutations at 13 positions were described in hyperactive Mrr1 [180] (Figure 9). Interestingly, hyperactive Mrr1 proteins were also shown to be able to confer Mdr1p-independent drug resistance probably through the regulation of oxydoreductases implicated in the detoxification of yeast cells after fluconazole exposure [183]. A blast analysis in C. dubliniensis allowed for the identification of a gene encoding for a protein that shares 91% of identity with Mrr1 of C. albicans [133] and able to complement a CaMrr1Δ mutant strain. The properties of CdMrr1 are similar to those of CaMrr1 and two types of alleles can also be distinguished. Until now 5 GOF mutations were identified and analyzed in hyperactive CdMrr1 proteins [133].

3.2. Target Alteration
3.2.1. Target Mutation

Another mechanism by which fungal pathogens are able to develop resistance is a decrease in antifungal affinity for their respective targets, without a major decrease in target activity. Such is the case for azole drugs, in which a decreased affinity between azole and a mutated lanosterol 14α-demethylase, can lead to resistance. A point mutation in the ERG11 gene that codes for lanosterol 14α-demethylase leads to the complete inhibition of the binding capacity of the azole drug to its target [184, 185]. Numerous of these point mutations identified in ERG11 were previously described, and their involvement in azole resistance was experimentally demonstrated for fungi such as Cryptococcus neoformans [186], C. albicans [187], (see also Figure 9), and C. tropicalis [167]. In Aspergillus fumigates, CYP51A and CYP51B encode two distinct forms of 14α-demethylase and mutations in the first of these two genes seem to be the most frequent mechanism responsible for azole resistance in clinical isolates. In this species, it was demonstrated that the nature of the nucleotide mutation, and therefore, the nature of the amino acid substitution, influences the development of resistance to different azole agents [188–192]. Interestingly, it was demonstrated that some clinical isolates share common mutations in Cyp51A with environmental azole-resistant strains, suggesting that some clinical azole resistant isolates might originate from the environment [193–195].

While target site alteration is far from being the most significant mechanism of resistance to azole drugs, it is the only known mechanism by which fungal pathogens are able to develop resistance to echinocandin drugs. This was demonstrated for S. cerevisiae and C. albicans. Echinocandin resistance is systematically associated with point mutations in either FKS1 or FKS2 [196, 197]. Analysis of the location of these mutations within the FKS genes led to the characterization of two regions, the so-called “hot spots”, integrity of which seems to be essential for enzyme activity [136]. In contrast to azoles and ERG11, mutations in FKS1 did not alter the β-glucane synthase affinity for its target but decreased only the enzyme processivity [198]. Hot-spot mutations have also been identified in other species, such as C. glabrata [196, 199], C. krusei [200], Scedosporium apiospermum [201], and A. fumigatus [202, 203] (Figure 9).

Numerous enzymes of the pyrimidine salvage pathway are involved in 5FC mode of action and thus numerous molecular mechanisms could lead to resistance to this drug [16, 204]. The most frequently found mechanism in clinical isolates of pathogenic fungi is a point mutation in the FUR1 gene that encodes the enzyme responsible for the conversion of 5FU into metabolites able to enter the cytosine metabolism (Figure 9) [14]. FUR1 mutation leads to complete resistance to both 5FC and 5FU in fungi. A second, frequently reported mutation leads only to resistance of 5FC. This second mutation is a point mutation in the FCY1 gene that codes for cytosine deaminase, the enzyme responsible for the conversion from 5FC into 5FU. Several such point mutations that lead to decreased activity of the cytosine deaminase were identified, essentially in Candida yeast species such as C. glabrata [205, 206] and in S. cerevisiae [207].

3.2.2. Target Expression Deregulation

A third mechanism of drug resistance is the deregulation of the drug target expression. For drugs targeting, the biosynthesis of ergosterol, such as azoles, terbinafine, or fenpropimorph, even relative short exposures of two to three hours lead to the transient upregulation of the ERG gene family in C. albicans, glabrata, tropicalis, and krusei [208]. These data suggest a common regulation of the ergosterol biosynthetic pathway in the presence of inhibitors. Longer azoles in vitro exposures (minimum 24 h) lead to constitutive upregulation of ERG genes, including ERG11 [209], and decrease drug susceptibility. In clinical isolates of C. albicans and C. dubliniensis resistant to azoles isolated from HIV patients, upregulation of ERG11 was described as a minor mechanism often combined with other more major mechanisms of resistance such as pump overexpression or ERG11 mutations [103, 169, 210]. The overexpression of ERG11 originates either by gene dosage effect through duplication of the gene or by upregulation of the gene by a trans-acting factors, both hypotheses were verified. In C. albicans and C. glabrata, it was shown that increased azole resistance due to ERG11 upregulation was in fact due to genome rearrangement via formation of an isochromosome in C. albicans and duplication of a chromosome in C. glabrata, and therefore amplification of ERG11 [163, 211]. In Cryptococcus neoformans, the well-known SRE1 gene was shown to regulate the ergosterol biosynthesis pathway and also to be involved with virulence of the fungus [212]. In S. cerevisiae, the ERG gene family was shown to be regulated by two zinc cluster transcription factors encoded by ScUPC2 and ScECM22. Two homologues of ScUPC2 were found in the genome of C. glabrata: CgUPC2A and CgUPC2B. It appears that while both transcription factors regulate sterol biosynthesis and exogenous uptake, only CgUpc2A is responsible for the regulation of the transcription of the ERG gene family in response to sterol inhibitors [213]. In C. albicans, only one gene homologue of ScUPC2/ScECM22 was found and named CaUPC2 [214, 215]. It was shown that CaUpc2 is necessary for the upregulation of ERG genes in the presence of ergosterol synthesis inhibitors. Moreover, the upc2 Δ/Δ mutant shows increased susceptibility to most drugs and a decrease in sterol uptake as compared to the wild-type strain [214, 215]. Further studies demonstrated the ability of CaUpc2 to bind to the ARE motif in the promoter of C. albicans ERG11 (Table 3) [215, 216]. Genome-wide location analysis of CaUpc2 confirmed the SRE motif as the DNA binding site, and also confirmed the ERG gene family as a CaUpc2 target as well as CDR1, MDR1, and UPC2 itself as new target genes. Analysis of clinical strains resistant to fluconazole with upregulated ERG11 expression, demonstrated the existence of a hyperactive allele of CaUPC2 that confers intrinsic upregulation of ERG genes. Currently, two GOF mutations were described for CaUpc2 (Figure 9) [134, 180].

3.3. Metabolism Modification
3.3.1. Echinocandins Paradoxical Effect

Some yeasts and filamentous fungi are able to grow in elevated echinocandin concentrations much higher than the MICs [136, 217]. This phenomenon, called paradoxical effect, is due to the metabolic adaptation of microorganism and is mediated by the cell wall integrity signalization pathway. This response is the direct consequence of the β(1-3)-glucans synthesis inhibition and the subsequent cell wall composition modifications, upon echinocandin administration [218, 219]. Several studies suggest that the magnitude of the paradoxical effect is variable depending on the microorganism itself as well as on the echinocandin nature. Therefore, the paradoxical effect would be more pronounced in the presence of caspofungin as compared to anidulafungin or micafungin [220]. However, the clinical significance of paradoxical effect has never been studied nor has it ever been observed in echinocandin-treated patients [86].

3.3.2.

De Novo Synthesis of Pyrimidines

It is possible that 5FC resistance could be the consequence of an overall induction of the de novo pyrimidine biosynthetic pathway. In this case, the antifungal drug competes with the regular pyrimidine intermediate metabolites for incorporation into nucleic acids [16]. This increase in activity of the de novo pyrimidine biosynthetic pathway is reflected by an increased expression of the CDC21 gene, whose product is inhibited by 5FC [205]. FUR1 mutations could lead to 5FC resistance. However, its downregulation has also been demonstrated to be involved in 5FC decreased susceptibility. A 4-fold decreased expression of this gene of high importance in 5FC mode of action is sufficient to lead to a total resistance to this pyrimidine fluorinated analog in C. glabrata [84].

3.3.3. Ergosterol Biosynthesis Pathway Alteration

Modifications of main metabolic pathways could also lead to azole drugs resistance. For example, alteration of the late steps of the ergosterol biosynthetic pathway through inactivation of the ERG3 gene gives rise to cross-resistance to all azole drugs [101]. Indeed, the antifungal activity of azole drugs relies on the synthesis of toxic 14α methylated sterols by the late enzymes of this pathway. A point mutation that occurs in the ERG3 gene can lead to the total inactivation of C5 sterol desaturase. In this case, toxic 14α methylated sterols are no longer synthesized and even in the presence of azole drugs sterols species able to replace ergosterol are generated. While very uncommon, this mechanism was identified in several clinical isolates of C. albicans [221–223].

3.3.4. Plasma Membrane Composition Variation

Polyene drugs do not require internalization into fungal cells in order to exert their antifungal activity, since they incorporate into the plasma membrane from the external side. Thus, they escape metabolizing enzymes and efflux systems, and the only possibility for fungi to develop resistance to polyene is to modify their target, ergosterol. However, ergosterol is responsible for the integrity and fluidity of the plasma membrane, and therefore, possibilities to compensate for its absence are very limited. Although rarely described, resistance mechanisms responsible for acquired or innate resistance to polyene drugs were studied in several fungal species. In each case, resistance to polyenes results from a decrease or total absence of ergosterol in the plasma membrane through mutations in nonessential genes of the ergosterol biosynthetic pathway [224]. Molecular polyene resistance mechanisms were described in laboratory mutants of yeasts belonging to the Candida genus and in S. cerevisiae. Thus, both ERG11 deletion in C. albicans [225] and ERG3 deletion in S. cerevisiae [226] lead to mutants with cross-resistance to azole and polyene drugs. Likewise, ERG6 inactivation in C. lusitaniae [227] and S. cerevisiae results in polyene resistance [228]. Regarding clinical isolates, very few data is available. Only a few studies have associated polyene resistance to an ERG3 mutation in clinical isolates of C. albicans [221, 229] and to an ERG6 mutation in C. glabrata [230, 231].

3.3.5. Biofilms

“United we stand, divided we fall”. This statement is certainly true concerning the fight between fungi and antifungals. It is well characterized that microbial communities engulfed in a polysaccharides-rich extracellular matrix, also known as biofilm, are by far more resistant to antifungal drugs than isolated cells. Fortunately, few pathogenic species within the fungal kingdom are able to form biofilms. The mostly known and widely studied of those species able to form biofilms are the species of the Candida genus [232]. Another yeast frequently responsible for biofilm-associated infections is Cryptococcus neoformans [233, 234]. Some clinical cases have also reported the involvement of other yeast species, such as Pichia fabianii [235] or Trichosporon asahii [236]. Additionally, it is now accepted that filamentous fungi, and particularly those of the Aspergillus genus, can grow as biofilms in humans [237–239]. Fungal biofilms are frequently polymicrobial biofilms, meaning that bacterial species frequently associate with one or several fungi [240, 241]. In medical mycology, biofilms constitute a real concern in the fields of invasive and dental medicine. They constitute a nonnegligible source of nosocomial fungal infections, essentially through the use medical devices. Moreover fungal biofilms are resistant to almost all the currently used antifungals, with the exceptions of echinocandins and lipid formulations of AmB [242]. The molecular mechanisms underlying the persistence of the fungal biofilms despite antifungal treatment remain unclear. It is likely that biofilm resistance is the result of a combination a multiple factors, among them an increased expression of efflux pumps, a modification of plasma membrane composition, and the biofilm-produced extracellular matrix itself [232, 243].

4. Development of New Antifungal Strategies

Current antifungal treatments are limited in their capacity to treat infections, especially systemic infections and no considerable advancements in antifungal therapies were developed recently. New therapies are therefore needed against pathogenic fungi. Several approaches were developed during the last several years in order to find new solutions. Researchers aim to discover new antifungal drugs either by testing already existing medical compounds, compounds from natural sources such as plants, sea, microorganisms or by systematic screens of chemical compound libraries. Researchers also strive to elucidate the underlying biology of fungal microorganism both in vitro and in vivo. Host-fungal interactions play a critical role for all fungal pathogens. Targeting this interaction provides novel therapies, which could be used alone or in combination with existing antifungal drugs. Such a combination may also determine the development of antifungal drug resistance.

4.1. Development of New Antifungal Active Compounds

Much effort has gone towards analyzing the antifungal properties of what is called natural compounds (NP) or natural bioactive compounds isolated from plants, other microorganisms, or marine organisms [244–246]. Some such compounds are investigated because their known triggering mechanisms important for fungi, while other compounds are tested blindly for their antifungal properties. Currently, none of these studies have produced a compound suitable for the clinical trial stage although interesting results were obtained.

Other studies focused on in vitro screens of several drugs currently used in clinical practice for their potentiation of the antifungal effect of the fungistatic agent fluconazole (FLC) on Candida albicans. This facilitated the discovery of several compounds, such as inhibitors of the calcineurin [247, 248] or Tor pathways [249–251], efflux pump inhibitors (derived compounds of milbemycin) [252–254], and more recently, antibodies against heat-shock 90 protein (HSP90) [255]. In particular, inhibitors of the calcineurin pathway were shown to be fully active in vivo in the potentiation of fluconazole, and they also led to a dramatic decrease in fungi virulence [256–260].

Systematic screening of chemical compounds libraries was also undertaken, essentially by industrial laboratories as an attempt to discover new antifungal compounds. High throughput screening of the legacy Schering-Plough compound collection has recently lead to the discovery of a new glucan synthase inhibitor effective again C. albicans and C. glabrata [261–263].

Some analysis used reverse genetic assay in which, C. albicans heterozygous deletion or transposon disruption mutants collection were screened for growth under treatment with collections of chemical compounds [264, 265]. This approach allowed identification of both antifungal drugs and the genes related to the mechanism of action of the related compounds.

Another type of high-throughput screens of chemical libraries was achieved measuring the viability of drug-treated Caenorhabditis elegans infected with C. albicans [266]. Compounds can be simultaneously screened for antifungal efficacy and host toxicity, which overcomes one of the main obstacles in current antimicrobial discovery. A pilot screen for antifungal compounds using this novel C. elegans system identified 15 compounds that prolonged survival of nematodes infected with the medically important human pathogen C. albicans. One of these compounds, caffeic acid phenethyl ester (CAPE), had effective antifungal activity in a murine model of systemic candidiasis and had in vitro activity against several other fungal species [266]. In addition, this whole-animal system may enable the identification of compounds that modulate immune responses and/or affect fungal virulence factors that are only expressed during infection.

4.2. Genome-Wide Studies to Detect Potential New Antifungal Targets

The improvement of already existing antifungal drugs and the limitation of drugs resistance apparition has helped to elucidate the basic biology of the fungal pathogen. For this purpose, several groups made efforts to develop collection of systematic mutants essentially for C. albicans. An important difficulty for antifungal therapy is to develop drugs that exploit factors unique to fungi, which can be challenging considering that organism are eukaryotic and share many conserved biological pathways. Genes that are essential to fungal survival are possible targets for drug development.

Using the GRACE (gene replacement and conditional expression) or CPR (conditional promoter replacement) technologies, some research groups have assessed the essentiality of C. albicans and Aspergillus fumigatus genes [267, 268]. One study identified 567 essential genes in C. albicans [267]. And another study screened 54 genes of A. fumigatus based on ortholog functions and essentiality in C. albicans and S. cerevisiae [268], of which 35 were defined as essential in A. fumigatus. Authors were able to show that while the ERG11 gene family (CYP51A and ERG11B) is essential in A. fumigatus, the individual genes themselves are not. These analyses provide interesting and fully informative data for antifungal drug design and improve upon previous in silico analyses that when using S. cerevisiae data were only able to identify 61% of homologous genes reported in the genes found in the Roemer et al. analysis [267].

The diploid state of the genome presents a major problem to the development of a mutant collection. Therefore, some collections consist of heterozygous deletion [265] or transposon disruption mutants [264, 265]. Other collections contain homozygous transposon disruption mutants based on the random insertion thanks to the Tn7 transposon to a UAU cassette [269, 270]. These collection were first restricted to the transcription factors of C. albicans [269, 271, 272] but continue to be enlarged for the entire genome [270, 273]. Other collections consist of deletion mutants constructed with PCR generated deletion cassettes, with two different markers for each allele in the case of C. albicans [274, 275]. Such collections are now being constructed for C. glabrata.

Three kinds of analyses detailed below were performed with these collections. They aimed a better understanding of the modifications occurring in the fungi submitted to antifungal treatments or of the relationship developed between the fungus and its host all along the infectious process. Such knowledge might improve the actual therapy to avoid resistance development or might allow playing on the host-fungus equilibrium to improve recovery of patients.

First of all, treating strains with already known antifungal drugs and analyzing for example, growth modification and later transcriptional rewiring, some authors try to better understand drugs mechanisms of action and/or to find synergistic effect between them [272, 274]. Gene encoding the transcription factor Cas5 was found to be involved in the response to caspofungin [272]. Other studies showed that AGE3, which encodes an ADP-ribosylation factor GTPase activating effector protein, if deleted, abrogates fluconazole tolerance in C. albicans. Interestingly, Brefeldin A, an inhibitor of ADP-ribosylation factor, resulted in a synergistic effect with other drugs for C. albicans as well as for Aspergillus [273]. Finally, Homann et al. screened a collection of 143 transcription factor mutants under 55 distinct conditions among which exposition to fluconazole and 5FC, and they conclude in their analysis that nearly a quarter of the knockout strains affected sensitivity to commonly used antifungal drugs [274].

Other studies were geared better understand the biology of fungal species. For this purpose, mutant collections were subjected to a wide range of environmental conditions, modifying elements such as pH, salt concentration, carbon sources, oxidative conditions, temperature, and availability of essential elements such as metals (iron, copper, zinc, etc.) [274, 276].

Understanding the relationship between fungus and host during infection may provide further information useful for the improvement of antifungal treatment. In order to analyze the cross-talk occurring between fungus and host during the infectious process, researchers screened the colonization properties of mutants directly in hosts. One study that was performed with 1201 gene knockout mutants of Cryptococcus neoformans analyzed their in vivo proliferation profile in the murine lung, and they were able to identify 40 infectivity mutants [277]. Gene deletions in these mutants were previously uncharacterized and did not show any defect in traits known to be linked to virulence (polysaccharide capsule formation, melanization, and growth at body temperature). At least, four other similar studies were performed with C. albicans mutants. Two of them were done in invertebrate host models such as C. elegans or D. melanogaster [266, 278]. Interestingly, the Cas5 Δ/Δ mutant, which has already been shown to be important for caspofungin response, was shown to be less virulent in both invertebrate models of infection [278, 279]. Finally, this transcription factor was demonstrated as crucial for cell wall integrity, and its importance in virulence was confirmed in the mice intravenous model of infection [278]. Two other studies screened collections of C. albicans mutants directly in mice by pools of mutants that were previously tagged [280, 281]. One collection was restricted to Zn2-Cys6 transcription factors (TF) mutants and the other was composed of mutants affecting about 11% of the entire C. albicans genome with no respect to a gene class. In both cases, mutants were also screened for traits known to be linked to virulence, such as the ability to filament and proliferate as well as the ability to grow at 42°C, at high and low pH, and in oxidative conditions. Noble et al. identified 115 mutants among the 674 screened with attenuated infectivity, but normal morphological switching and proliferation [281]. More precisely, they identified glycolipid and glucosylceramide as the first small molecules synthesized by C. albicans that are specifically required for virulence. Vandeputte et al. identified two Zn2-Cys6 TF mutants within 77 tested. These mutants displayed attenuated infectivity in their pool test, which was also confirmed in independent single strains infection of mice ZCF13 and ZCF18 [280]. Both genes were previously uncharacterized. ZCF18 showed a slight growth defect in contrast to ZCF13 which grew normally at body temperature, but slightly less at 42°C. ZCF13 mutant displayed an abnormal morphology, producing strongly filamentous colonies on YPD medium at 35°C and displaying high invasion ability. ZCF18 deletion also led to a slight enhancement of colony wrinkling. Both genes are currently under further analysis.

Unfortunately, whenever promising, up to now, no new compound and/or new target have been selected for further development from these approaches.

5. Conclusion

These last years were very rich in better knowledge of molecular basis of antifungal resistance and more generally of the metabolism of pathogenic fungi. Antifungal drug resistance appears to essentially be due to point mutations in either drug targets or transcription factors regulating actors of the resistance. In the near future, high throughput diagnostic tools could be used in the course of treatment of fungal infections in order to detect resistance and adjust therapeutic strategies accordingly before any clinical evidence and therefore allow a rapid adjustment of the antifungal treatment.

One of the challenges of finding new antifungal targets in C. albicans was the lack of sophisticated screening technologies often employed with other fungal species such as Saccharomyces cerevisiae. The recent application of genome-wide studies to pathogenic fungi for both host-pathogen interactions and the biological study will hopefully encourage and facilitate the development of new effective therapeutic strategies. Such improvements in antifungal treatment may lead to a better clinical outcome.

Acknowledgment

The authors would like to thank Shawna McCallin for proofreading of the paper.

90,000 description of the disease, symptoms, diagnosis, treatment

Background information on the disease Microsporia (Ringworm) (cats, cats): description, symptoms, signs, diagnosis, treatment of pets

Animal species:

Cats, cats

Description of disease:

A highly contagious fungal disease characterized by lesions of the skin and its derivatives.

Causes of the development of the disease

The disease is caused by fungi of the genus Microsporon. They affect cats, dogs, rats, mice and humans. Fungi have a filamentous, unbranched body and form a large number of spores, which contributes to their widespread distribution. They are highly resistant to heat and disinfectants and remain in the environment for a long time.

Animals of all ages are infected, but young animals are especially sensitive from the first days of life.The disease in cats is recorded at any time of the year. It manifests itself in the form of isolated (sporadic) cases and in the form of massive outbreaks.

Symptoms of the disease

The disease is accompanied by itching. The superficial form is characterized by hair loss and breakage, the formation of hairless, scaly patches of a rounded shape. Signs of exudation (the presence of an inflammatory focus on the skin) are subtle. Lesions can be focal and multiple.With a deep (follicular) form, the inflammatory process is pronounced, crusts of dried exudate form on the surface of the skin. Small spots may coalesce to form large, crusted foci. The deep form of microsporia is less common and only in advanced cases. The atypical form is characterized by the appearance of hairless or sparsely coated patches.

Disease Diagnostics

Microsporia in cats is diagnosed taking into account epizootological data, clinical signs and the results of special research methods.

Disease Treatment

Personal preventive measures must be strictly observed. Before applying medicinal preparations, the affected skin areas are treated with warm water and soap. Apply 5-10% salicylic ointment, 10% salicylic alcohol, iodoform. Antifungal antibiotics are prescribed – griseofulvin, nystatin. Aerosol medicines are used – cubatol and zoomikol. Treatment is carried out under the supervision of a veterinarian.For therapeutic and prophylactic purposes, highly effective, reliable and low-toxic live and inactivated vaccines are used.
The general prevention of microsporia consists in the specific and timely vaccination of cats, compliance with veterinary and sanitary rules in the premises, creating normal conditions for keeping, providing animals with full-value feed, and carrying out regular disinfection.

Diseases by animal species

Funny Video

Looks like this 5 year old basketball player just can’t miss!

Need money before your paycheck?

more than 30 services

Online credits to the card in 15 minutes

up to 180 days

max term

to 20,000 UAH

max sum

Trichophytosis is… What is Trichophytosis?

Dermatophytosis, trichophytosis (also dermatomycosis, dermatophytosis, ringworm) – skin infections caused by fungi Trichophyton and Microsporum . As a rule, carriers of the causative agents of this disease are young and middle-aged children, as well as animals, while the disease caused by infection from animals passes in a more severe form. Infection occurs through direct contact with the patient, when using common hats, clothing and other items.The disease manifests itself in the form of at first a single, and subsequently multiple foci, which are red or pink spots, peeling is observed on the skin. Such foci can appear on the scalp, trunk, and nails.

Classification

There are several different types of fungus. Dermatophytes of the genera Trichophyton and Microsporum are the most common pathogens. Trichophytosis (ringworm) is caused mainly by the fungi Trichophyton violaceum , Trichophyton tonsurans , as well as by some species of Microsporum.Microsporia) and most often affects the hairy parts of the body.

Dermatophytosis:

  • Tinea pedis (American – “athlete’s foot”) affects feet
  • Tinea unguium – affects nails on hands and feet
  • Tinea corporis – surface of arms, legs, body
  • Tinea cruris (Amer. – “jock itch”) also known as “eczema marginatum” – groin and armpits
  • Tinea manuum – palm and hands
  • Tinea capitis – scalp
  • Tinea barbae – face and head hair
  • Tinea faciei (Amer.- “face fungus”) – face

Other superficial mycoses (non-classical dermatophytosis caused by non-dermatophytes)

In foreign literature, dermatophytosis and ringworm are considered a common cause of eczema. In the Russian literature, eczema is not associated with fungal infection. At the same time, sometimes eczema is treated with hormonal ointments, whereas if it is caused by a fungal disease, such treatment is strictly contraindicated, fungi multiply more actively under the action of such ointments.

Treatment

Antifungal drugs are used for the treatment of dermatophytosis: Miconazole, terbinafine, Clotrimazole, Ketoconazole, Mikoseptin.

For the treatment of Tinea pedis, drugs of the Azole group are more effective, for example, Clotrimazole, Ketoconazole. For the treatment of especially difficult cases, when the skin, hair or nails are deeply affected, Griseofulvin is used orally. Severely advanced cases of Tinea pedis and Tinea manuum are treated externally with selenium sulfide, although it has strong side effects and contraindications.

Formulations containing terbinafine and tolnaftate are well suited for treating ringworm (pink, red and light brown spots).

A 5% alcohol solution of iodine is also used.

The course is continued for 1–2 weeks (until the symptoms disappear) and 1 week after that, to exclude a relapse.

In the most difficult cases, especially when the scalp and scalp are affected, systemic treatment with oral medications is prescribed.

Treatment should be carried out only as directed and under the supervision of a mycologist, since many antifungal drugs have a teratogenic effect and adversely affect the functioning of the liver.

To exclude relapses, the following measures must be taken:

  • After visiting “dangerous” public places, use antifungal soap containing agents such as tar, lavender oil, tea tree oil, turpentine, agent Terpinen-4-ol.
  • often (at least every second day) wash hair, body
  • do not use other people’s towels, soap, linen
  • use rubber slippers in saunas, swimming pools, changing rooms, beaches
  • Wash all linen in contact with the body in 90–100 ° C water or simply in hot water with fungicidal soap
  • in rooms where patients lived (especially if it is an animal), wash all surfaces with a mixture of 1:10 (hypochlorite) bleach, which kills fungal spores.
  • if there is wool left in the room from sick animals – thoroughly vacuum, with immediate discard of the bag, and according to some recommendations – and a vacuum cleaner. In isolated cases, a change of residence is also required.

Prevention

The fungus loves humid, warm, dark places. Respectively:

  • You should wear dry shoes and socks (change shoes and socks at least once a day).
  • Do not wear synthetic shoes / socks / underwear.
  • According to some recommendations, it is worth wearing more ventilated underwear, or not wearing underwear at all.Sleeping in pajamas or underwear is not recommended.
  • Observe the rules of personal hygiene, wash at least once every two days, preferably with fungicidal soap.
  • Use rubber slippers in saunas, swimming pools, changing rooms, beaches.
  • Exclusion of contact with sick people and animals.

Literature

References

Foreign sources:

D01A
Antifungal preparations for topical use (dermatological)
J02A
Antifungals for systemic use
—-

90,000 treatment with folk and pharmaceutical remedies, photo

Dermatophytosis is characterized by inflammation, redness, peeling of smooth skin and epidermis under the hair on the head.Ringworm in children is treated with drugs for external use – ointments, antiseptic solutions. Medicines are applied directly to the site of infection to suppress the growth of mycelium of fungi. The effectiveness of local therapy depends on strengthening local and general immunity, compliance with hygiene requirements. The duration of treatment is from 1-3 weeks to several months.

Contents of article

How does ringworm manifest?

Trichophyton and microsporum mushrooms feed on keratin – the main building block of skin and hair.Damage occurs in the form of a red ring, thickened from the edge. The light center of the spot expands, here you can notice the restoration of healthy skin. The disease is associated with itching and flaking, hair loss in children on the head.

The medical names for ringworm are “trichophytosis”, “microsporia”, “dermatophytosis”. Fungi belonging to the genera Trichophyton and Microsporum are spread in the stratum corneum by filamentous mycelium around the original lesion, as in the photo below.

Clinical manifestations of ringworm in a child:

  1. Round spots with broken hair and well defined borders. The size of the foci of baldness on the head is from 3 to 5 millimeters.
  2. Ring-shaped or round spots on the skin, colored red with a pink heart.
  3. The surface of the focus is covered with light scales, the boundaries are clearly defined.
  4. The border of the spot is colored bright red, consists of crusts, rises above healthy skin.
  5. Itching periodically intensifies, but in general, the focus is small in area, does not bother the child a little.

Ringworm on a child’s head can be recognized by broken hair shafts, peeling of the skin. This disease is called “clipping” for its similarity to a short haircut. Sometimes scabs and pus appear in the focus. Symptoms such as burning and pain are aggravated by bacterial infection, suppuration and inflammation. Then the child develops a fever, the lymph nodes swell.

Fungal infection is transmitted to children through contact with infected people, yard and domestic animals. Mostly preschoolers and younger students are ill.

Ringworm infection is associated with the formation of a huge number of spores that are resistant to heat and various antiseptic substances. The fungus is able to survive in the crevices of the floor, the villi of the pet’s litter, in the soil. The incubation period in children after the penetration of spores into the epidermis lasts from 1-2 weeks to 2 months.If the local immunity is weak, then the spores grow faster into the mycelium.

How is trichophytosis diagnosed?

The dermatologist at the reception uses a Wood lamp, which creates a luminescent glow, to examine the affected area of ​​the smooth skin or scalp. The fungus is identified by its greenish color on a purple background. Doctors also use other methods, because each method individually does not always provide an accurate picture.

For microscopic examination in the laboratory, they examine scrapings from spots on the patient’s skin.Examine the specimen under a microscope to look for ringworm cells. In addition, spores are inoculated on nutrient media in laboratory conditions. The specialist examines the culture and accurately determines the species of the fungus that has affected the skin.

How to treat ringworm in a child?

Methods of therapy for dermatomycosis are not always effective, although self-healing is possible after the end of adolescence. The doctor decides how to cure the child, which drugs to give preference to.The dermatologist chooses the active ingredient and dosage according to the type of infectious agent, the age and health of the patient, and the severity of the disease.

International generic names for ringworm:

  • Imidazoles: bifonazole, clotrimazole, econazole, isoconazole, ketoconazole, miconazole, oxyconazole.
  • Antifungal antibiotics: griseofulvin, nystatin.
  • Allylamines: naftifine, terbinafine.
  • Triazoles: fluconazole, itraconazole.
  • Morpholine: amorolfine.

Treatment of ringworm in children requires a picky attitude to the choice of drugs. It is very important not to start the disease, because a deep skin lesion leads to atrophy of the hair follicles, the appearance of noticeable scars. Fungus on the scalp and hair is treated with oral medications. The mycelium affects the hair follicles in the dermis, and when the ointment is applied, the concentration of the active ingredient is low.

How to treat trichophytosis of the head?

Hair is washed with therapeutic shampoo with ketoconazole or selenium disulfide every other day for 6 weeks.According to reviews, the second remedy is less irritating to the skin. In difficult cases, the doctor prescribes tablets, capsules or suspensions with drugs griseofulvin, terbinafine, itraconazole, flucanosol to the patient with ringworm.

At the same time apply externally antiseptic solutions and medicinal creams. The hair on the head of children is shaved daily only in the area of ​​spots or completely.

Griseofulvin tablets are prescribed orally for severe ringworm and other fungal diseases.The approximate dose is 10-25 mg per 1 kg of the patient’s body weight. Pediatricians recommend drinking a teaspoon of vegetable oil along with the tablets to increase the duration of the drug. Therapy continues for 2–2.5 months after symptoms improve. Side effects of the drug: increased sensitivity to light, weakness, dizziness, abdominal pain, vomiting, diarrhea.

Terbinafine capsules are prescribed for oral administration. If the child’s weight is less than 20 kg, then 62.5 mg / kg / day is given.A child over 4 years old can take 125 mg of the drug once a day. The dose for the treatment of ringworm in children weighing 35–40 kg is 250 mg. Treatment lasts 4–8 weeks. Side effects of the drug: rash, itching, change in taste, abdominal pain, vomiting, diarrhea.

How to treat ringworm on a child’s body?

The best result is achieved through the combined use of local antiseptics with antifungal ointments. Antiseptic agents act on mycelium and spores, do not damage epidermal cells.Iodine tincture 5%, salicylic alcohol 2%, Castellani liquid (fucorcin) are used to cauterize ringworm spots in children. The area affected by the fungus is treated with an antiseptic twice a day.

Solutions, ointments, gels, creams and lotions with antifungal components are applied externally. The active ingredient of Lamisil gel – terbinafine – acts as a fungicide, destroys ringworm pathogens. The drug is used to treat children from 12 years of age. The dermatological gel is applied once a day to the ringworm stain and rubbed in gently.The duration of the course of therapy is 7 days. Already in the first day of use, there are signs of improvement.

Sulfur ointment for ringworm in children contains medical sulfur and petroleum jelly. The agent is applied to the affected area of ​​the skin before going to bed under a bandage. Apply sulfuric ointment until complete recovery.

Parents consider treatment with folk remedies safe for children. However, the effectiveness of alternative methods is often low. Herbs, apple cider vinegar, garlic propolis tincture and other folk remedies can be used in addition to the main treatment of dermatomycosis in a child.

How to prevent ringworm infections?

The patient is considered recovered after the already formed lesions heal and new spots do not appear. Previously affected areas should not have a green glow under a Wood’s lamp. Scraping from the skin is performed three times with an interval of a week. In laboratory tests, there should be no fungal spores.

Prevention of ringworm in children:

  1. Wash hands thoroughly with antibacterial soap after outdoors, playing with pets.
  2. Do not use other people’s things and objects – a comb, clothes and hats, a towel.
  3. Wash clothes and linen in hot water, after drying, iron with a hot iron.
  4. To wipe toys and various surfaces in the house with disinfectant solutions.
  5. Keep baby’s skin dry, especially in folds.
  6. Avoid contact with stray animals.
  7. Treat sick pets.

Parents should pay attention to the appearance of dandruff in children, as a harbinger of seborrheic dermatitis and trichophytosis.A fungal infection weakens the skin and hair. The child scratches his head, the hair splits, breaks. You need to treat ringworm patiently, do not skip the ingestion or applying antimycotic drugs to the skin.

90,000 overview of traditional and new drugs

The origin of itchy spots and blisters on the skin is associated with the growth of microscopic fungi in the cells of the epidermis, a viral infection. An effective ointment for lichen for children, recommended by a dermatologist, will help to quickly cure a fungal disease.First, the doctor will determine the type of infectious agent, its sensitivity to drugs.

Contents of article

How to treat lichen in a child

The fungus parasitizes in the epidermis, where the causative agent of the disease feeds on keratin. First, a small area of ​​the skin changes, then the size of the lesion increases. A fungal infection affects children with weakened immune systems.

Ringworm is easy to recognize in a child by symptoms such as rounded pink-red spots, itching, flaking, hair loss.The lesions appear on the head, limbs, trunk.

The appearance of scaly patches is considered the main symptom of fungal lichen. At home, lichen ointments for children from the pharmacy and folk remedies are used. After applying the antifungal agent for 5-6 days, itching and the size of the lesion decrease. The total duration of the course of therapy is 1–2 months.

External remedies against lichen: pros and cons

Ointment – a dosage form of soft consistency, contains one or more substances.Differences with gels and creams lie in the peculiarities of the base, the depth of penetration into the skin. Most pharmacy ointments contain medical petroleum jelly. Creams are made on the basis of vegetable oils, lanolin. They spread more easily and evenly on the skin. The auxiliary components reduce inflammation and protect the affected skin.

It does not matter how to smear lichen in a child – ointment, cream or gel. The active substances penetrate into the uppermost layers of the epidermal cells, where the fungal mycelium is located.

Combined preparations contain antibiotics, antifungal and hormonal substances. Such a composition has both advantages and disadvantages. The use of a combined anti-lichen ointment for children allows you to quickly get rid of the clinical manifestations of microbial infection and inflammation. However, a more effective drug can have severe side effects. Hormonal components cause skin atrophy with prolonged use. Antibiotics have a negative effect on the entire microflora, including beneficial types of bacteria.

The cheapest ointment for getting rid of children from skin fungus

Ringworm, pityriasis and pityriasis in children are treated with external agents with antifungal active ingredients. Skin stains of mycotic origin must be treated with antiseptics. Iodine tincture 5%, chlorhexidine, salicylic alcohol are suitable. Apply the solution only to the site of infection once or twice a day. Deprive in young children is treated with iodine tincture of 3%, a few peas of baby cream are added to the medicinal ointment.

How to anoint lichen in a child:

  1. Riodoxol ointment is an inexpensive and effective remedy recommended for the treatment of dermatomycosis in children. The drug was produced and tested in Russia. The active ingredient is triiodresorcinol.
  2. Sulfur ointment is an affordable drug for the treatment of skin diseases of infectious and non-infectious origin.
  3. Sulfur-salicylic ointment has antimicrobial properties, anti-inflammatory effect and promotes proper exfoliation.
  4. Yam ointment contains tar, carbolic acid, sulfur, ichthyol, turpentine and other components to get rid of skin parasites in pets and humans.

Sulfur interacts with organic compounds in the composition of epidermal cells, the reaction products have antiparasitic and antimicrobial properties. Sulfur ointment helps cleanse the skin of dead cells. The basis of the drug – an emulsion of petroleum jelly with water – softens and protects the epidermis, accelerates healing.

Sulfur ointment for the treatment of lichen in a child is used for 5-7 days.Apply the product in a thin layer in the morning and evening, apply a bandage on top.

The combination of sulfur with tar has a detrimental effect on microbial infection. The tool is powerful, but it causes a lot of problems. A sharp smell of tar is immediately felt and persists for a long time. Irritation of the mucous membranes of the eyes and upper respiratory tract is possible. A child is unlikely to agree to have an unpleasant-smelling product applied to his skin.

The combination of sulfur, carbolic acid, ichthyol, tar, turpentine and other ingredients in the “Yam” ointment has a destructive effect on skin parasites.The external product has an unpleasant odor and color. Components can cause severe allergic reactions and skin burns.

Overview of ointments with synthetic antifungal agents and antibiotics

On pharmacy shelves there are an abundance of preparations for external use with clotrimazole, ketoconazole, mycosolone, terbinafine. This is just the beginning of the list of medicines with fungicidal and fungistatic effects. As a rule, the price in pharmacies is higher for ointments and creams with the latest antifungal substances in the composition.

How to treat lichen in a child:

  1. Nystatin ointment contains the antifungal antibiotic nystatin. The drug has been used for several decades; strains resistant to it have appeared.
  2. “Clotrimazole” cream is produced on the basis of the active ingredient of the same name. The tool is used to treat ringworm and varicoloured lichen. Apply to foci of fungal infection twice a day.
  3. Mikoseptin ointment contains undecylenic acid.The drug is produced by a Czech pharmaceutical company. The manufacturer recommends in the instructions to apply the product to the affected skin twice a day for 2 weeks.
  4. Miconazole ointment, Mikozon cream – antifungal agents based on miconazole. Mixed skin infections – fungal and bacterial – can be treated.
  5. Nizoral Cream and Shampoo contains ketoconazole. The antifungal agent helps fight ringworm and pityriasis pathogens in children.
  6. Creams “Terbinafine”, “Lamisil”, “Fungoterbin” are produced on the basis of terbinafine.The drug has a fungicidal effect, it is used as part of ointments, creams, gels, sprays.

Terbinafine destroys pathogens of ringworm and varicoloured lichen, candidiasis of the skin. The drug with this active substance is applied to the affected areas once or twice a day. Age restrictions for the use of ointment and cream – 12 years, for solution – 15 years, for gel and spray – 18 years. The effect of terbinafine on the child’s body is not well understood.


Topical treatment with lichen ointment for children is carried out at home and helps to quickly get rid of small foci of infection.When the disease becomes chronic, the antifungal agent should be changed periodically. In summer, moderate insolation is useful for a child to heal the skin and harden the body.

90,000 Lichen in chinchillas – Diseases and treatment of chinchillas

Many have heard about this disease and many are afraid of it. In fact, there is nothing terrible. This disease is calmly and successfully treated, does not cause pain and inconvenience to your chinchilla . Lichen affects many domestic animals, as well as predatory and fur-bearing animals.Lichen is the general name for fungal skin diseases such as trichophytosis, microsporia.

Obvious symptoms are manifested in the form of baldness on the face, legs, tail. Dandruff remains at the site of the lost hair. The incubation period of this disease is from 7 to 30 days. In veterinary clinics, the presence of the fungus is visible under Wood’s lamp: the affected areas immediately glow green under the lamp. The disease in some cases can be transmitted to people, but mostly people with weakened immunity can get sick.The fungus can be brought from the street on your clothes or shoes, and hay or branches can also be affected by the fungus, so you cannot cut branches for chinchillas in the city. Also, the fungus can appear as a result of stress in the chinchilla. The showcase or cage must be cleaned once a week and disinfected once a month. Keeping your pet clean is a prevention against lichen.

But what if the animal did get sick with shingles? What to do? There are several methods of treatment for lichen. You can smear the affected area with sprays or ointments, capturing healthy areas of the skin by about a centimeter.The animal must be isolated from others in a separate showcase or in a cage. But there is a more reliable method of combating the fungus – this is the injection of Vakderma 0.2 intramuscularly, repeat after 2 weeks. When using Vakderma, it is no longer necessary to smear with ointments and sprays. Add a crushed nystatin tablet or 1 teaspoon of fungistop or 10 grams of sulfur to 1 cup (200g) of sand to the chinchilla sand. We put the sand in the window every day. Accordingly, in addition to the chinchilla’s dwelling, you need to disinfect the bowl and drinker.And as a preventive measure, you can have in the room where you have a chinchilla, a bactericidal lamp, for example, a bactericidal lamp, a recirculator “Bioquartz CH-1”. It works in the presence of humans and animals due to the built-in fan, the air in the room is driven through an ultraviolet lamp, destroys 99% of pathogenic bacteria and viruses in the room.

90,000 Symptoms and treatment of fungus in cats

Fungi that cause disease in cats can be divided into 4 groups:

Ringworm dermatophytes : Ringworm pathogens belonging to 2 genera – Microsporum and Trichophyton .They pose a health hazard not only to domestic animals, but also to humans. Parasitizing the skin and its appendages (hair and claws), they cause in cats the formation of hairless areas on the head, neck, trunk, tail and limbs covered with stumps of broken hair and scales of the epidermis. For treatment, vaccines, antifungal agents (tablets, ointments), an alcohol solution of iodine are used;

Dermatophytes causing scab: In cats, scab is mainly caused by Microsporum incurvatum .Are scab pathogens of other species of animals and humans dangerous for this species of animals ( Trichophyton schoenleinii , Trichophyton quinckeanum , Trichophyton violaceum , Trichophyton verrucosum , 90sporum audouinii 9022i 90sporum audouini Microsporum gypseum , Microsporum canis , Achorion arlongi , Achorion quickeanum ) remains an open question.

The disease is manifested by the appearance of scab-like crusts (skutul) on the skin of the muzzle, ears (most often) and paws (less often in other parts of the body). They are in the shape of a saucer, cup or shield with a depressed inner part. Initially, the crusts are colored yellow and have a soft texture. As they age, they become gray and crumbly, fine-grained. The skin under the scutula thickens, its outer edges rise upward, hair falls out (along the perimeter of the lesions, they break off, as with ringworm, and completely fall out in the center).

The affected areas of the skin are of different shapes and sizes, ranging from millet to beans. Sick cats usually do not itch as much as ringworm does. No specific treatment and prophylaxis means have been developed for scab. Local treatments are also carried out with the same preparations as ringworm. Tar and ointments based on it (for example, Yam ointment) are especially effective. To speed up the removal of scutules from the skin, they are often lubricated with vegetable oils.

Malassezia : Malassezia pachydermatis is a yeast fungus that is a component of normal skin microflora.With improper care of the latter, the absence of regular cleaning of the ears, the presence of concomitant bacterial infections, this fungus can cause dermatitis and otitis media.

The symptomatology of these manifestations of malasseziosis is nonspecific. For treatment, nystatin and other antifungal drugs (ketoconazole, itraconazole) are used in the form of tablets or ointments, creams, sprays. In the case of otitis media, regular and thorough cleaning of the ears is necessary, and with a mixed course of this fungal infection with bacterial, antibiotic therapy is also carried out.

Candida : There are at least 5 species of this yeast in cats. Like malassezia, they are commensals, that is, components of normal microflora, but not skin, but mucous membranes.

Most often they affect the mucous membrane of the oral cavity and genitourinary system.